Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G12500 58 / 2e-11 PR-3, PR3, CHI-B, B-CHI, ATHCHIB PATHOGENESIS-RELATED 3, basic chitinase (.1) AT3G04720 43 / 3e-06 HEL, PR-4, PR4 HEVEIN-LIKE, pathogenesis-related 4 (.1) AT3G54420 39 / 0.0001 ATCHITIV, CHIV, ATEP3 CHITINASE CLASS IV, homolog of carrot EP3-3 chitinase (.1) AT2G43580 38 / 0.0003 Chitinase family protein (.1) AT2G43610 37 / 0.0007 Chitinase family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10041830 [exp] 104 / 1e-28 AT3G12500 402 / 4e-141 PATHOGENESIS-RELATED 3, basic chitinase (.1) Lus10028377 [exp] 102 / 1e-27 AT3G12500 393 / 1e-137 PATHOGENESIS-RELATED 3, basic chitinase (.1) Lus10006552 [exp] 47 / 1e-07 AT3G04720 244 / 1e-82 HEVEIN-LIKE, pathogenesis-related 4 (.1) Lus10001772 [exp] 41 / 8e-06 AT2G43610 44 / 5e-06 Chitinase family protein (.1) Lus10020338 [exp] 41 / 1e-05 AT2G43620 57 / 2e-10 Chitinase family protein (.1) Lus10003586 [exp] 38 / 0.0001 AT2G43610 43 / 4e-06 Chitinase family protein (.1) Lus10003585 [exp] 37 / 0.0001 AT3G12500 47 / 1e-07 PATHOGENESIS-RELATED 3, basic chitinase (.1) Lus10001773 [exp] 38 / 0.0003 AT2G43570 51 / 6e-08 "chitinase, putative", chitinase, putative (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.009G141700 [exp] 69 / 2e-15 AT3G12500 405 / 3e-142 PATHOGENESIS-RELATED 3, basic chitinase (.1) Potri.009G142300 [exp] 68 / 7e-15 AT3G12500 340 / 1e-116 PATHOGENESIS-RELATED 3, basic chitinase (.1) Potri.009G141800 [exp] 64 / 1e-13 AT3G12500 351 / 9e-121 PATHOGENESIS-RELATED 3, basic chitinase (.1) Potri.009G142000 [exp] 63 / 4e-13 AT3G12500 346 / 6e-119 PATHOGENESIS-RELATED 3, basic chitinase (.1) Potri.004G182000 [exp] 63 / 4e-13 AT3G12500 460 / 5e-164 PATHOGENESIS-RELATED 3, basic chitinase (.1) Potri.013G041600 [exp] 51 / 4e-09 AT3G04720 266 / 3e-91 HEVEIN-LIKE, pathogenesis-related 4 (.1) Potri.004G182100 [exp] 45 / 1e-06 AT3G12500 306 / 7e-103 PATHOGENESIS-RELATED 3, basic chitinase (.1) Potri.013G041700 [exp] 44 / 2e-06 AT3G04720 248 / 4e-84 HEVEIN-LIKE, pathogenesis-related 4 (.1) Potri.013G041900 [exp] 42 / 5e-06 AT3G04720 251 / 1e-85 HEVEIN-LIKE, pathogenesis-related 4 (.1) Potri.005G054000 [exp] 39 / 0.0001 AT3G04720 238 / 9e-81 HEVEIN-LIKE, pathogenesis-related 4 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF00187 [flax] [poplar] Chitin_bind_1 Chitin recognition protein
Representative CDS sequence Show only first row Show all	>Lus10041828 pacid=23146787 polypeptide=Lus10041828 locus=Lus10041828.g ID=Lus10041828.BGIv1.0 annot-version=v1.0 ATGGAACGTTCAATTCGAACCAGTAGTACTCCACCAACTCTCGTAGTTACATTGGCGCTCTTGTTTATAGCTGCCACCGCAGAGAACTGCGAGAGCCAAG CAGGGAACGCGGTGTGTCCGGGCGGCCTATGCTGCAGCCGGTTCGGCTGGTGCGGCAACACTGCGGATCACTGCACAAATGGCTGCCAGAGCCAATGTAC TCCGCAAGGTGATGGTGGGGCCACCCCAACCCCGACCCCATCCGGAGGAGGATGA
AA sequence Show only first row Show all	>Lus10041828 pacid=23146787 polypeptide=Lus10041828 locus=Lus10041828.g ID=Lus10041828.BGIv1.0 annot-version=v1.0 MERSIRTSSTPPTLVVTLALLFIAATAENCESQAGNAVCPGGLCCSRFGWCGNTADHCTNGCQSQCTPQGDGGATPTPTPSGGG

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT3G12500		PR-3, PR3, CHI-...	PATHOGENESIS-RELATED 3, basic ...		Lus10041828 [exp]	0	1
AT2G15220			Plant basic secretory protein ...		Lus10019807 [exp]	13.4	0.8929
AT3G07310			Protein of unknown function (D...		Lus10003162 [exp]	21.4	0.8871
AT3G56710		SIB1	sigma factor binding protein 1...		Lus10039493 [exp]	24.2	0.8842
AT2G42010		PLDBETA1	phospholipase D beta 1 (.1)		Lus10042282 [exp]	30.2	0.8528
AT1G77760		GNR1, NIA1	nitrate reductase 1 (.1)		Lus10031005 [exp]	33.2	0.7944
AT5G05350			PLAC8 family protein (.1)		Lus10001260 [exp]	36.7	0.8710
AT5G06500	MADS	AGL96	AGAMOUS-like 96 (.1)		Lus10029367 [exp]	45.0	0.8712
AT1G79460		ATKS1, ATKS, GA...	GA REQUIRING 2, ARABIDOPSIS TH...		Lus10004906 [exp]	50.8	0.8427
AT5G40690			unknown protein		Lus10015261 [exp]	51.2	0.8632
AT1G16670			Protein kinase superfamily pro...		Lus10042460 [exp]	66.0	0.8407

Compare expression of checked genes

Lus10041828 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.