Lus10042098 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10001241 185 / 2e-62 ND /
Poplar homologues

No hit found

PFAM info
Representative CDS sequence
>Lus10042098 pacid=23153573 polypeptide=Lus10042098 locus=Lus10042098.g ID=Lus10042098.BGIv1.0 annot-version=v1.0
ATGGCAAAGGTAGTTCGAGGTCTCAAATCCGGTTTCTTCAACATCGTCGGAGCTCTCAAGGGCGGCGGCCGACCAACCACCGTCGACGAACCAGTTCCCC
TGTCACCGACTCCTGCAACTACTGCCGCCGGGAAGAGCAATGAAATAGTTTATGCGGGCGAAGCTCAGAAACAAGCGGTCGTCCACATAGGAGAAGCTCG
TGAGGATCTATACGTGGAAGCTTCCGAGTTCAAATCCGTTCAGGTGTTGAAAATGGTCCGATCTAGAGAACCGGGAGGAGTACCTAAAGGTTCTCGTCCA
GGAACTGGCTGA
AA sequence
>Lus10042098 pacid=23153573 polypeptide=Lus10042098 locus=Lus10042098.g ID=Lus10042098.BGIv1.0 annot-version=v1.0
MAKVVRGLKSGFFNIVGALKGGGRPTTVDEPVPLSPTPATTAAGKSNEIVYAGEAQKQAVVHIGEAREDLYVEASEFKSVQVLKMVRSREPGGVPKGSRP
GTG

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
Lus10042098 0 1
AT3G27970 Exonuclease family protein (.1... Lus10008787 6.9 0.8058
AT2G36970 UDP-Glycosyltransferase superf... Lus10016127 24.2 0.8236
AT3G46060 ARA3, Ara-3, At... RAB GTPase homolog 8A (.1.2.3) Lus10007698 27.5 0.8131
Lus10027950 27.7 0.8222
AT5G16120 alpha/beta-Hydrolases superfam... Lus10017601 31.7 0.8411
AT5G62960 unknown protein Lus10032130 34.9 0.8067
AT5G53190 SWEET3, AtSWEET... Nodulin MtN3 family protein (.... Lus10014932 35.3 0.7948
AT4G04750 Major facilitator superfamily ... Lus10000924 43.2 0.8332
AT3G51860 CAX1-LIKE, ATHC... cation exchanger 3 (.1) Lus10002490 49.3 0.7615
AT5G22050 Protein kinase superfamily pro... Lus10013365 55.5 0.7841

Lus10042098 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.