Lus10042198 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT2G01510 183 / 8e-55 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
AT3G53360 169 / 8e-49 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
AT3G29230 167 / 2e-48 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
AT1G28690 164 / 4e-48 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
AT1G77170 163 / 4e-48 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
AT5G66520 165 / 7e-48 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
AT2G36730 163 / 9e-48 Pentatricopeptide repeat (PPR) superfamily protein (.1)
AT4G33990 166 / 1e-47 EMB2758 embryo defective 2758, Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
AT4G21065 160 / 4e-47 Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2)
AT3G49142 164 / 5e-47 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10008618 360 / 8e-123 AT4G33990 367 / 4e-117 embryo defective 2758, Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Lus10002024 175 / 3e-52 AT5G56310 344 / 6e-113 Pentatricopeptide repeat (PPR) superfamily protein (.1)
Lus10013319 167 / 8e-49 AT4G21065 744 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2)
Lus10022890 169 / 1e-48 AT3G61170 865 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Lus10005207 165 / 1e-47 AT4G21065 741 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2)
Lus10030124 163 / 1e-47 AT3G15130 613 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Lus10024876 164 / 1e-46 AT3G12770 886 / 0.0 mitochondrial editing factor 22 (.1)
Lus10000706 163 / 2e-46 AT3G12770 878 / 0.0 mitochondrial editing factor 22 (.1)
Lus10029344 161 / 2e-46 AT5G06540 803 / 0.0 Pentatricopeptide repeat (PPR) superfamily protein (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.006G252400 181 / 1e-54 AT4G21065 496 / 8e-172 Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2)
Potri.001G258500 181 / 5e-53 AT2G40720 481 / 4e-157 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.017G001000 176 / 5e-52 AT4G21065 793 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1), Tetratricopeptide repeat (TPR)-like superfamily protein (.2)
Potri.013G103600 173 / 7e-51 AT1G08070 477 / 7e-160 ORGANELLE TRANSCRIPT PROCESSING 82, EMBRYO DEFECTIVE 3102, Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.016G019900 169 / 9e-49 AT4G02750 542 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.003G006800 169 / 1e-48 AT3G16610 687 / 0.0 pentatricopeptide (PPR) repeat-containing protein (.1)
Potri.013G044700 169 / 1e-48 AT3G22690 582 / 0.0 unknown protein
Potri.005G019400 165 / 1e-48 AT1G09190 574 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.005G005700 167 / 3e-48 AT3G49142 912 / 0.0 Tetratricopeptide repeat (TPR)-like superfamily protein (.1)
Potri.004G208000 166 / 4e-48 AT2G03880 939 / 0.0 required for efficiency of mitochondrial editing 1, Pentatricopeptide repeat (PPR) superfamily protein (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0020 TPR PF01535 PPR PPR repeat
Representative CDS sequence
>Lus10042198 pacid=23153537 polypeptide=Lus10042198 locus=Lus10042198.g ID=Lus10042198.BGIv1.0 annot-version=v1.0
ATGTACGCAAAATGTGGGGATATGGATCGAGCTCGATCGGTCTTCGATGAGATACTGTGTAAGGATGTAATATCTTGGACAACTATGATTCTAGGTCATG
CCATCAATGGTGAAGGAGAGGAAGCCCTCCTTGCTTTCCACGAAATGCGTGAGGAAGGAATCAGGCCGAATTTCGTGACATTCATCGGGGTTCTGTCGGC
ATTTAATCATTCCGGTCTGGTAGAAGCAGGCCAGAAGTTATACGAGATGATGATCCAGGCTGACGATATTGAGCCAAAGATGGAGCATTACGGATGTATG
ATCGATATGCTTGCCCGAGCAGGGATGCTCGAGGAGGCAAAGAAGTTCGTGGAGAGAATGCCGGTGGAGCCAAATGCAGCTGTTTGGAGGATGCTGGTTA
ATGCTTGCAGAGGTCACAGTGCTACTAAACTCGGATTGAGCTCAGTGGCTAACCTCTTTCCAGGGAGGAATTCAACTGTGGTTGCTGAAAATCGGATTAT
TTGTGCTAACATGTTTGCTGAGGCAGAGAGATGGAATGAAGTTTTGCAAGATCGACCTATTATGGTTGCCCAGAAGGATCGTAAAGTAGCTGGCAAAAGC
TCCACTGTAACGTAA
AA sequence
>Lus10042198 pacid=23153537 polypeptide=Lus10042198 locus=Lus10042198.g ID=Lus10042198.BGIv1.0 annot-version=v1.0
MYAKCGDMDRARSVFDEILCKDVISWTTMILGHAINGEGEEALLAFHEMREEGIRPNFVTFIGVLSAFNHSGLVEAGQKLYEMMIQADDIEPKMEHYGCM
IDMLARAGMLEEAKKFVERMPVEPNAAVWRMLVNACRGHSATKLGLSSVANLFPGRNSTVVAENRIICANMFAEAERWNEVLQDRPIMVAQKDRKVAGKS
STVT

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT2G01510 Tetratricopeptide repeat (TPR)... Lus10042198 0 1
AT5G14950 GMII, ATGMII golgi alpha-mannosidase II (.1... Lus10032179 15.8 0.7954
AT5G65820 Pentatricopeptide repeat (PPR)... Lus10011566 19.4 0.7811
AT1G76990 ACR3 ACT domain repeat 3 (.1.2.3.4.... Lus10028646 21.9 0.7592
AT5G65280 GCL1 GCR2-like 1 (.1) Lus10035926 24.2 0.7673
AT4G26590 ATOPT5 ARABIDOPSIS THALIANA OLIGOPEPT... Lus10022541 28.0 0.7766
AT1G04110 SDD1 STOMATAL DENSITY AND DISTRIBUT... Lus10002243 34.6 0.7666
AT4G30080 ARF ARF16 auxin response factor 16 (.1) Lus10023519 39.9 0.7661
AT1G20650 ASG5 ALTERED SEED GERMINATION 5, Pr... Lus10013222 82.0 0.7192
AT4G00050 bHLH bHLH016, UNE10 unfertilized embryo sac 10, ba... Lus10003471 86.1 0.7406
AT5G43870 Plant protein of unknown funct... Lus10021903 89.7 0.7293

Lus10042198 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.