Lus10042238 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10026416 65 / 2e-13 AT5G52410 42 / 0.001 unknown protein
Poplar homologues

No hit found

PFAM info
Representative CDS sequence
>Lus10042238 pacid=23153979 polypeptide=Lus10042238 locus=Lus10042238.g ID=Lus10042238.BGIv1.0 annot-version=v1.0
ATGGGTGGTAACACACGTAAGGTGAGGCTATTGAAAGAGAAAGAGGAGGAACTCGAGAAGGCGGATGAGGCGAAAGATGAAGAATTGGGGAAGTTGAAGA
AGGGGAAAGATGAAGAGATAAGAGTGGCGAGGAAGAAGAAGGATGGAGAGAAGGCAAAGGTTAGGAAAACAGAGGAAACTTTGGAGAAGCTGAAAGTGGA
GATGGAGGATGCGAAGGAGGAGCTGCAGAGGATTCTACGTGAGCAAAATGGCAGAGTGCATATACAATCAGCAAGAAGGATTGAAGAACTAGAGAAAGAA
AAGGATGAAGAGCTACAGAAGATAATTCGAGAGAAAGATGAGAAACTGTAG
AA sequence
>Lus10042238 pacid=23153979 polypeptide=Lus10042238 locus=Lus10042238.g ID=Lus10042238.BGIv1.0 annot-version=v1.0
MGGNTRKVRLLKEKEEELEKADEAKDEELGKLKKGKDEEIRVARKKKDGEKAKVRKTEETLEKLKVEMEDAKEELQRILREQNGRVHIQSARRIEELEKE
KDEELQKIIREKDEKL

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
Lus10042238 0 1
AT5G37060 ATCHX24 cation/H+ exchanger 24, ARABID... Lus10031852 4.2 0.9002
AT3G52820 ATPAP22, PAP22 purple acid phosphatase 22 (.1... Lus10017059 4.8 0.7742
AT2G04230 FBD, F-box and Leucine Rich Re... Lus10030031 5.7 0.7486
AT5G11730 Core-2/I-branching beta-1,6-N-... Lus10034348 6.3 0.8960
AT1G65450 HXXXD-type acyl-transferase fa... Lus10029920 7.7 0.8960
AT5G45670 GDSL-like Lipase/Acylhydrolase... Lus10011999 8.9 0.8804
AT2G40190 LEW3 LEAF WILTING 3, UDP-Glycosyltr... Lus10007909 10.0 0.8784
AT4G36590 MADS MADS-box transcription factor ... Lus10026366 10.1 0.5553
AT1G02030 C2H2ZnF C2H2-like zinc finger protein ... Lus10031166 11.0 0.8590
Lus10011637 11.0 0.8753

Lus10042238 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.