Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G39950 162 / 7e-48 CYP79B2 "cytochrome P450, family 79, subfamily B, polypeptide 2", cytochrome P450, family 79, subfamily B, polypeptide 2 (.1) AT2G22330 161 / 1e-47 CYP79B3 "cytochrome P450, family 79, subfamily B, polypeptide 3", cytochrome P450, family 79, subfamily B, polypeptide 3 (.1) AT5G05260 159 / 8e-47 CYP79A2 cytochrome p450 79a2 (.1) AT1G58260 139 / 3e-39 CYP79C3P, CYP79C2 cytochrome p450 79c2 (.1) AT1G16410 135 / 7e-38 SPS1, BUS1, CYP79F1 SUPERSHOOT 1, BUSHY 1, cytochrome p450 79f1 (.1.2) AT1G16400 132 / 7e-37 CYP79F2 "cytochrome P450, family 79, subfamily F, polypeptide 2", cytochrome P450, family 79, subfamily F, polypeptide 2 (.1) AT1G79370 129 / 7e-36 CYP79C1 "cytochrome P450, family 79, subfamily C, polypeptide 1", cytochrome P450, family 79, subfamily C, polypeptide 1 (.1) AT5G35917 117 / 2e-31 CYP79A3P "cytochrome P450, family 79, subfamily A, polypeptide 3 pseudogene", cytochrome P450, family 79, subfamily A, polypeptide 3 pseudogene (.1) AT1G01280 89 / 5e-21 CYP703A2 "cytochrome P450, family 703, subfamily A, polypeptide 2", cytochrome P450, family 703, subfamily A, polypeptide 2 (.1) AT4G37340 86 / 3e-20 CYP81D3 "cytochrome P450, family 81, subfamily D, polypeptide 3", cytochrome P450, family 81, subfamily D, polypeptide 3 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10026341 [exp] 246 / 2e-80 AT4G39950 563 / 0.0 "cytochrome P450, family 79, subfamily B, polypeptide 2", cytochrome P450, family 79, subfamily B, polypeptide 2 (.1) Lus10023144 [exp] 219 / 2e-69 AT4G39950 604 / 0.0 "cytochrome P450, family 79, subfamily B, polypeptide 2", cytochrome P450, family 79, subfamily B, polypeptide 2 (.1) Lus10023143 [exp] 209 / 1e-65 AT4G39950 605 / 0.0 "cytochrome P450, family 79, subfamily B, polypeptide 2", cytochrome P450, family 79, subfamily B, polypeptide 2 (.1) Lus10031145 [exp] 207 / 3e-65 AT4G39950 561 / 0.0 "cytochrome P450, family 79, subfamily B, polypeptide 2", cytochrome P450, family 79, subfamily B, polypeptide 2 (.1) Lus10023142 [exp] 200 / 5e-65 AT4G39950 345 / 4e-116 "cytochrome P450, family 79, subfamily B, polypeptide 2", cytochrome P450, family 79, subfamily B, polypeptide 2 (.1) Lus10031151 [exp] 203 / 2e-63 AT4G39950 603 / 0.0 "cytochrome P450, family 79, subfamily B, polypeptide 2", cytochrome P450, family 79, subfamily B, polypeptide 2 (.1) Lus10031726 [exp] 201 / 1e-62 AT4G39950 573 / 0.0 "cytochrome P450, family 79, subfamily B, polypeptide 2", cytochrome P450, family 79, subfamily B, polypeptide 2 (.1) Lus10000239 [exp] 91 / 4e-22 AT2G22330 331 / 7e-110 "cytochrome P450, family 79, subfamily B, polypeptide 3", cytochrome P450, family 79, subfamily B, polypeptide 3 (.1) Lus10010373 [exp] 89 / 3e-21 AT4G37370 375 / 3e-126 "cytochrome P450, family 81, subfamily D, polypeptide 8", cytochrome P450, family 81, subfamily D, polypeptide 8 (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G055200 [exp] 164 / 6e-49 AT4G39950 590 / 0.0 "cytochrome P450, family 79, subfamily B, polypeptide 2", cytochrome P450, family 79, subfamily B, polypeptide 2 (.1) Potri.013G157400 [exp] 160 / 2e-47 AT4G39950 556 / 0.0 "cytochrome P450, family 79, subfamily B, polypeptide 2", cytochrome P450, family 79, subfamily B, polypeptide 2 (.1) Potri.013G157200 [exp] 160 / 4e-47 AT4G39950 580 / 0.0 "cytochrome P450, family 79, subfamily B, polypeptide 2", cytochrome P450, family 79, subfamily B, polypeptide 2 (.1) Potri.002G171800 [exp] 85 / 6e-20 AT1G01280 778 / 0.0 "cytochrome P450, family 703, subfamily A, polypeptide 2", cytochrome P450, family 703, subfamily A, polypeptide 2 (.1) Potri.007G084200 [exp] 82 / 1e-18 AT3G26300 385 / 1e-129 "cytochrome P450, family 71, subfamily B, polypeptide 34", cytochrome P450, family 71, subfamily B, polypeptide 34 (.1) Potri.007G085000 [exp] 82 / 1e-18 AT5G07990 402 / 5e-135 TRANSPARENT TESTA 7, CYTOCHROME P450 75B1, Cytochrome P450 superfamily protein (.1) Potri.006G141400 [exp] 81 / 2e-18 AT5G07990 373 / 6e-124 TRANSPARENT TESTA 7, CYTOCHROME P450 75B1, Cytochrome P450 superfamily protein (.1) Potri.007G084700 [exp] 81 / 2e-18 AT5G07990 397 / 5e-134 TRANSPARENT TESTA 7, CYTOCHROME P450 75B1, Cytochrome P450 superfamily protein (.1) Potri.018G051300 [exp] 81 / 3e-18 AT5G07990 379 / 9e-127 TRANSPARENT TESTA 7, CYTOCHROME P450 75B1, Cytochrome P450 superfamily protein (.1) Potri.009G069100 [exp] 80 / 4e-18 AT5G07990 512 / 1e-178 TRANSPARENT TESTA 7, CYTOCHROME P450 75B1, Cytochrome P450 superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF00067 [flax] [poplar] p450 Cytochrome P450
Representative CDS sequence Show only first row Show all	>Lus10042319 pacid=23153630 polypeptide=Lus10042319 locus=Lus10042319.g ID=Lus10042319.BGIv1.0 annot-version=v1.0 ATGAGGGAAGCGGATTATTTGCCGTGGTTGAGATGGATGAACATTGATGGACAGGAAAGAATCGTTAAAGAGGCGAATTCGACGTTGAGGATTTACCAAG ACCCGATTATTGATGAGAGGATCCGAGTTTGGGAGAGAAATGAGAGGGAGGAGATGGATGAGTTGACTGATGTTTTCATTACTCTCAAGGATGCGCTGAT CAACCAACCGGATCTCCTCGCCAAGGCAACCGAGGAAATCGACCGGGTCGTCGGAAAAAACCGGCTGGTCCAAGAGTCCGACATCGGGAGCTTGAACTAC ATGAAGGCATGTGCTAGGGAGTCATTTCCGCTGCACCATATGTTACCATTCAACGGACCGCACGTAGCCACTCAAGACACCGTTGTCGCCGGCTACTTCA TTCCCAAAGGAAGCCACGCGCTCCTCAGTCGCTACGGCCTGGGCAACCCGAACGCCTAG
AA sequence Show only first row Show all	>Lus10042319 pacid=23153630 polypeptide=Lus10042319 locus=Lus10042319.g ID=Lus10042319.BGIv1.0 annot-version=v1.0 MREADYLPWLRWMNIDGQERIVKEANSTLRIYQDPIIDERIRVWERNEREEMDELTDVFITLKDALINQPDLLAKATEEIDRVVGKNRLVQESDIGSLNY MKACARESFPLHHMLPFNGPHVATQDTVVAGYFIPKGSHALLSRYGLGNPNA

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G22330		CYP79B3	"cytochrome P450, family 79, s...		Lus10042319 [exp]	0	1
AT5G38195			Bifunctional inhibitor/lipid-t...		Lus10017615 [exp]	10.3	0.8127
					Lus10027774 [exp]	14.8	0.7946
AT3G51680		AtSDR2	short-chain dehydrogenase/redu...		Lus10016175 [exp]	16.1	0.8088
AT1G59970			Matrixin family protein (.1)		Lus10014512 [exp]	16.6	0.6667
AT2G18180			Sec14p-like phosphatidylinosit...		Lus10028332 [exp]	18.2	0.8071
AT3G28345		MDR13, ABCB15	multi-drug resistance 13, ATP-...		Lus10036616 [exp]	20.0	0.6161
AT1G61560		ATMLO6, MLO6	MILDEW RESISTANCE LOCUS O 6, S...		Lus10036120 [exp]	20.5	0.8021
AT4G40070			RING/U-box superfamily protein...		Lus10035931 [exp]	33.7	0.7812
AT3G19020			Leucine-rich repeat (LRR) fami...		Lus10012047 [exp]	34.0	0.7891
					Lus10010253 [exp]	35.3	0.7752

Compare expression of checked genes

Lus10042319 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.