Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G34810 79 / 6e-20 SAUR-like auxin-responsive protein family (.1) AT4G34800 77 / 1e-19 SAUR-like auxin-responsive protein family (.1) AT4G38850 71 / 3e-17 SAUR-AC1, ATSAUR15, ATSR15AU, SAUR15, SAUR_AC1 SMALL AUXIN UP RNA 1 FROM ARABIDOPSIS THALIANA ECOTYPE COLUMBIA, ARABIDOPSIS COLUMBIA SAUR GENE 1, ARABIDOPSIS THALIANA SMALL AUXIN UPREGULATED 15, SAUR-like auxin-responsive protein family (.1) AT4G34770 67 / 1e-15 SAUR-like auxin-responsive protein family (.1) AT4G34790 67 / 2e-15 SAUR-like auxin-responsive protein family (.1) AT2G21210 67 / 2e-15 SAUR-like auxin-responsive protein family (.1) AT3G03820 64 / 3e-14 SAUR-like auxin-responsive protein family (.1) AT4G38840 64 / 4e-14 SAUR-like auxin-responsive protein family (.1) AT3G03840 63 / 5e-14 SAUR-like auxin-responsive protein family (.1) AT5G18050 62 / 1e-13 SAUR-like auxin-responsive protein family (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10012181 [exp] 100 / 4e-28 AT4G34770 97 / 3e-27 SAUR-like auxin-responsive protein family (.1) Lus10007564 [exp] 99 / 2e-27 AT4G34770 97 / 3e-27 SAUR-like auxin-responsive protein family (.1) Lus10012184 [exp] 76 / 1e-18 AT4G34810 125 / 9e-39 SAUR-like auxin-responsive protein family (.1) Lus10008995 [exp] 73 / 1e-17 AT4G38840 119 / 2e-36 SAUR-like auxin-responsive protein family (.1) Lus10042378 [exp] 72 / 2e-17 AT4G34810 129 / 3e-40 SAUR-like auxin-responsive protein family (.1) Lus10007561 [exp] 72 / 3e-17 AT4G34810 125 / 1e-38 SAUR-like auxin-responsive protein family (.1) Lus10026294 [exp] 72 / 4e-17 AT4G34810 124 / 3e-38 SAUR-like auxin-responsive protein family (.1) Lus10029198 [exp] 71 / 5e-17 AT4G38840 119 / 2e-36 SAUR-like auxin-responsive protein family (.1) Lus10007563 [exp] 71 / 1e-16 AT4G34800 87 / 2e-23 SAUR-like auxin-responsive protein family (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.009G127500 [exp] 76 / 9e-19 AT2G21210 128 / 5e-40 SAUR-like auxin-responsive protein family (.1) Potri.004G166100 [exp] 75 / 1e-18 AT2G21210 119 / 2e-36 SAUR-like auxin-responsive protein family (.1) Potri.004G165200 [exp] 71 / 5e-17 AT5G18020 122 / 6e-38 SAUR-like auxin-responsive protein family (.1) Potri.004G164800 [exp] 70 / 1e-16 AT4G38840 120 / 3e-37 SAUR-like auxin-responsive protein family (.1) Potri.009G127400 [exp] 69 / 4e-16 AT4G34770 111 / 3e-33 SAUR-like auxin-responsive protein family (.1) Potri.009G126900 [exp] 68 / 7e-16 AT4G38840 131 / 1e-41 SAUR-like auxin-responsive protein family (.1) Potri.009G127600 [exp] 68 / 2e-15 AT5G18080 116 / 7e-35 small auxin up RNA 24, SAUR-like auxin-responsive protein family (.1) Potri.009G127700 [exp] 67 / 2e-15 AT5G18080 114 / 1e-34 small auxin up RNA 24, SAUR-like auxin-responsive protein family (.1) Potri.004G164700 [exp] 67 / 3e-15 AT5G18020 122 / 8e-38 SAUR-like auxin-responsive protein family (.1) Potri.009G126300 [exp] 66 / 4e-15 AT5G18060 123 / 2e-38 SAUR-like auxin-responsive protein family (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF02519 [flax] [poplar] Auxin_inducible Auxin responsive protein
Representative CDS sequence Show only first row Show all	>Lus10042379 pacid=23153793 polypeptide=Lus10042379 locus=Lus10042379.g ID=Lus10042379.BGIv1.0 annot-version=v1.0 ATGGGGATTCGTCATCTGCCATCTTCCGTCATTTCTGGAGCAAAGCAGATTCTTAAGAGACAGTCTTCTTCTTCCTCATCATCTTCGTCCTCCTCTTCGT CTTCGTCTTCGTCAACATCGTCACCTTCCTCTTCTCCGAGCCGATTTAGGAGGTCGAAGAGCGTTCCGAAAGGTCACATTGCGGTGTATGTTGGTGGAGA AGTCGACGAGAGGAAAAGATTCGTGGTCCCCATCTCGTTTCTCAGCGACCCATTGTTCCTGGAATTGCTCAAACTAGCTGAGGAAGAGTTTGGCTACAAT CCTCCGCTAGGAAACCTCACCATCCCCTGTCATGAGCATGCCTTCGTCACTCTCATTTCCTCTCGCTTCGAAGCTTCATTGGTAAATTGA
AA sequence Show only first row Show all	>Lus10042379 pacid=23153793 polypeptide=Lus10042379 locus=Lus10042379.g ID=Lus10042379.BGIv1.0 annot-version=v1.0 MGIRHLPSSVISGAKQILKRQSSSSSSSSSSSSSSSSSTSSPSSSPSRFRRSKSVPKGHIAVYVGGEVDERKRFVVPISFLSDPLFLELLKLAEEEFGYN PPLGNLTIPCHEHAFVTLISSRFEASLVN

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT4G34810			SAUR-like auxin-responsive pro...		Lus10042379 [exp]	0	1
					Lus10023767 [exp]	1.4	0.9000
AT5G65730		XTH6, XTR10	xyloglucan endotransglucosylas...		Lus10039643 [exp]	3.6	0.9022
AT1G08510		FATB	fatty acyl-ACP thioesterases B...		Lus10017751 [exp]	4.9	0.7968
					Lus10016100 [exp]	5.2	0.8835
AT5G25840			Protein of unknown function (D...		Lus10011427 [exp]	6.0	0.8719
AT1G66370	MYB	ATMYB113	myb domain protein 113 (.1)		Lus10023027 [exp]	6.5	0.8252
AT5G65730		XTH6, XTR10	xyloglucan endotransglucosylas...		Lus10011597 [exp]	9.2	0.8613
AT5G49340		TBL4	TRICHOME BIREFRINGENCE-LIKE 4 ...		Lus10016856 [exp]	11.7	0.8396
AT5G09520		PELPK2	Pro-Glu-Leu|Ile|Val-Pro-Lys 2,...		Lus10039881 [exp]	13.4	0.8140
AT1G78955		CAMS1	camelliol C synthase 1 (.1)		Lus10016441 [exp]	13.9	0.8603

Compare expression of checked genes

Lus10042379 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.