Lus10042618 [FLAX]


External link
JGI Phytozome v13
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT3G63210 44 / 7e-06 MARD1 MEDIATOR OF ABA-REGULATED DORMANCY 1, Protein of unknown function (DUF581) (.1)
AT4G17670 39 / 0.0003 Protein of unknown function (DUF581) (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10022073 177 / 2e-58 AT3G63210 59 / 5e-11 MEDIATOR OF ABA-REGULATED DORMANCY 1, Protein of unknown function (DUF581) (.1)
Poplar homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.002G050100 57 / 3e-11 AT3G63230 59 / 3e-12 Protein of unknown function (DUF581) (.1), Protein of unknown function (DUF581) (.2)
Potri.005G212500 50 / 1e-08 AT3G63230 54 / 8e-10 Protein of unknown function (DUF581) (.1), Protein of unknown function (DUF581) (.2)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0175 TRASH PF04570 zf-FLZ zinc-finger of the FCS-type, C2-C2
Representative CDS sequence
>Lus10042618 pacid=23181816 polypeptide=Lus10042618 locus=Lus10042618.g ID=Lus10042618.BGIv1.0 annot-version=v1.0
ATGGCCGGGAAGCGATCTCGCATCTCACAGTCTCCGAGCTTCGGCAACACTGGCGTCGTGCTCGACCGTCGACCGATCCAAGATGAGGATCACCAGAAGC
AGCGCTGGGAATCTCAGCTCACGGCGATCGACACTACTGCTGCGACGTCTCCCGATCACTCTCCTCAGGGGATTTTTGCCTTGTGTTCGATTCTGCCGCC
CCTGCCGTTGTCATCTCCTCCGGCGAGGAAGACTGAGCGCGCTGATTCCACGGCTCACTTTCTGGATCGGTGCTTCTATTGCAAGAAGAGATTGGATCAC
AGACAGGACATCTACATGTACGGATCCGCTCTTGCTGAATCTGCATCACTCGGGGAAGATCGTCTAGATTAA
AA sequence
>Lus10042618 pacid=23181816 polypeptide=Lus10042618 locus=Lus10042618.g ID=Lus10042618.BGIv1.0 annot-version=v1.0
MAGKRSRISQSPSFGNTGVVLDRRPIQDEDHQKQRWESQLTAIDTTAATSPDHSPQGIFALCSILPPLPLSSPPARKTERADSTAHFLDRCFYCKKRLDH
RQDIYMYGSALAESASLGEDRLD

DESeq2's median of ratios [FLAX]

Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol HYPR_s2_CTRR_s2_FoxR_s4_CTRR_s4_FoxR_r1_CTRR_r1_FoxR_r3_CTRR_r3_FoxR_r1s2_CTRR_r1s2_FoxR_r3s2_CTRR_r3s2_FoxR_s6_CTRR_s6_Al4R_s6_Al12R_s6_Al24R_s8_CTRR_s8_Al4R_s8_Al12R_s8_Al24R_r5_CTRR_r5_Al4R_r5_Al12R_r5_Al24R_r7_CTRR_r7_Al4R_r7_Al12R_r7_Al24LEAF_NLEAF_PLEAF_NPKSAMAR_BetAR_rdfcPARTOP_BetTOP_rdfiFIBaiFIBbMID_BetMID_rdftFIBatFIB_GrtFIB_LitFIB_BitFIBbtFIBb_PUL8tFIBb_PUL24tFIBb_PUL96tFIBb_OPP8tFIBb_OPP24tFIBb_OPP96sXYLasXYLbsXYLb_PUL8sXYLb_PUL24sXYLb_PUL96sXYLb_OPP8sXYLb_OPP24sXYLb_OPP96
AT3G63210 MARD1 MEDIATOR OF ABA-REGULATED DORM... Lus10042618 0 1
AT2G04280 unknown protein Lus10041091 11.1 0.7901
AT1G12000 Phosphofructokinase family pro... Lus10038700 21.0 0.7593
AT5G64090 unknown protein Lus10020420 24.2 0.7721
AT3G63210 MARD1 MEDIATOR OF ABA-REGULATED DORM... Lus10022073 25.9 0.7547
AT1G30630 Coatomer epsilon subunit (.1) Lus10038422 34.0 0.7551
AT2G04280 unknown protein Lus10036415 47.6 0.7373
AT2G19860 ATHXK2 ARABIDOPSIS THALIANA HEXOKINAS... Lus10025815 53.2 0.7290
AT1G65560 Zinc-binding dehydrogenase fam... Lus10040589 72.4 0.6622
AT1G02570 unknown protein Lus10025023 73.4 0.7151
AT5G01090 Concanavalin A-like lectin fam... Lus10027751 74.2 0.6579

Lus10042618 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.