Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10001127 [exp] 138 / 5e-44 ND 45 / 1e-07
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G122800 [exp] 72 / 3e-18 AT5G67265 / unknown protein Potri.007G048400 [exp] 43 / 1e-06 AT5G67265 56 / 7e-12 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10042633 pacid=23181877 polypeptide=Lus10042633 locus=Lus10042633.g ID=Lus10042633.BGIv1.0 annot-version=v1.0 ATGAACACAAAGGAGGTAGAGAGGTTGAATGAGGAAGGTGCAATAGAGACCAAAGTGGAGACTGTAGATCATCGGTCATCGGCAGGGGAAGGAGAAGCCG GGAGAGAAAAGGTTGGAGTTGTTCATCTGCGGCGGAATAATAATGATGATAAGTACTCCTCCAGTACTGCCGGAGGTGTACTGGCGGGTGCAGCTGCTGC AGTTTCCAATACTTTGAAGTCTACCAAGGAAGCCATCACGGGTAAAGGCAACAGTGACAGCAAGCAGCCTGGTGGCACAGATAATCCACAGTGA
AA sequence Show only first row Show all	>Lus10042633 pacid=23181877 polypeptide=Lus10042633 locus=Lus10042633.g ID=Lus10042633.BGIv1.0 annot-version=v1.0 MNTKEVERLNEEGAIETKVETVDHRSSAGEGEAGREKVGVVHLRRNNNDDKYSSSTAGGVLAGAAAAVSNTLKSTKEAITGKGNSDSKQPGGTDNPQ

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G67265			unknown protein		Lus10042633 [exp]	0	1
AT5G05970		NEDD1	NEURAL PRECURSOR CELL EXPRESSE...		Lus10040260 [exp]	1.0	0.9213
AT1G80930			MIF4G domain-containing protei...		Lus10002210 [exp]	2.4	0.8940
AT3G19184	B3		AP2/B3-like transcriptional fa...		Lus10014586 [exp]	6.3	0.8375
AT3G14360			alpha/beta-Hydrolases superfam...		Lus10037465 [exp]	6.9	0.8906
AT3G53010			Domain of unknown function (DU...		Lus10042636 [exp]	8.4	0.8027
AT2G22300	CAMTA	SR1, CAMTA3	CALMODULIN-BINDING TRANSCRIPTI...		Lus10024044 [exp]	9.0	0.8560
AT4G09890			Protein of unknown function (D...		Lus10033529 [exp]	9.5	0.8688
AT5G24550		BGLU32	beta glucosidase 32 (.1)		Lus10030577 [exp]	9.9	0.7923
AT4G16120		ATSEB1, COBL7	ARABIDOPSIS THALIANA SEC61 BET...		Lus10010022 [exp]	10.6	0.8466
AT4G08300			nodulin MtN21 /EamA-like trans...		Lus10028030 [exp]	12.6	0.8750

Compare expression of checked genes

Lus10042633 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.