Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G65660 49 / 3e-08 hydroxyproline-rich glycoprotein family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10028221 [exp] 146 / 1e-46 AT5G65660 66 / 1e-14 hydroxyproline-rich glycoprotein family protein (.1) Lus10032818 [exp] 79 / 3e-20 AT5G65660 84 / 7e-22 hydroxyproline-rich glycoprotein family protein (.1) Lus10028220 [exp] 79 / 5e-20 AT5G65660 100 / 3e-28 hydroxyproline-rich glycoprotein family protein (.1) Lus10042927 [exp] 62 / 1e-13 AT5G65660 95 / 6e-26 hydroxyproline-rich glycoprotein family protein (.1) Lus10002158 [exp] 56 / 5e-11 AT5G65660 146 / 3e-46 hydroxyproline-rich glycoprotein family protein (.1) Lus10039633 [exp] 52 / 1e-09 AT5G65660 147 / 1e-46 hydroxyproline-rich glycoprotein family protein (.1) Lus10019240 [exp] 51 / 2e-08 AT5G10560 407 / 1e-133 Glycosyl hydrolase family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G108100 [exp] 69 / 4e-16 AT5G65660 95 / 6e-26 hydroxyproline-rich glycoprotein family protein (.1) Potri.019G055500 [exp] 54 / 4e-10 AT5G65660 114 / 2e-33 hydroxyproline-rich glycoprotein family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Lus10042928 pacid=23181922 polypeptide=Lus10042928 locus=Lus10042928.g ID=Lus10042928.BGIv1.0 annot-version=v1.0 ATGATGAATTTGTACGAAGAAAACGAGAGGTCAGTGATTGGTGTACCTCTGGGATTAATTCTTCTGGTGGTGACTCTGTTAGCCATGTGTGGAGTCTTCA TCTGCTGCCTTTACTGGGATAGGATTCCTCTCAGTTCCCCTCCTACCCACAACAACAAACCATCCCCTCATCACCTGAAGGCGAGCATGAATAAAGTGGA GAGCTTGCCAGTTTTGATGCCAGGAGACAAAGTCCCCAGCTGTATAGCCATGTCCTGTCCCTGCAAGCCGCCGGTGGCAAATTTGGAGACCATCGTTCAA TTGCCGGACAAACCTGCAGCCCCTCCTCTGTTTTAG
AA sequence Show only first row Show all	>Lus10042928 pacid=23181922 polypeptide=Lus10042928 locus=Lus10042928.g ID=Lus10042928.BGIv1.0 annot-version=v1.0 MMNLYEENERSVIGVPLGLILLVVTLLAMCGVFICCLYWDRIPLSSPPTHNNKPSPHHLKASMNKVESLPVLMPGDKVPSCIAMSCPCKPPVANLETIVQ LPDKPAAPPLF

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G65660			hydroxyproline-rich glycoprote...		Lus10042928 [exp]	0	1
AT1G05160		ATKAO1, CYP88A3	ENT-KAURENOIC ACID OXYDASE 1, ...		Lus10033105 [exp]	2.6	0.8155
AT1G11190		ENDO1, BFN1	ENDONUCLEASE 1, bifunctional n...		Lus10018452 [exp]	5.5	0.7958
AT3G51630		ATWNK5, ZIK1, W...	with no lysine (K) kinase 5 (....		Lus10022747 [exp]	10.9	0.8073
AT1G21450	GRAS	SCL1	SCARECROW-like 1 (.1)		Lus10029747 [exp]	19.4	0.7788
AT1G53580		GLY3, GLX2-3, E...	GLYOXALASE 2-3, ETHE1-LIKE, gl...		Lus10007336 [exp]	21.2	0.7375
					Lus10004020 [exp]	24.3	0.7277
AT4G21865			unknown protein		Lus10023724 [exp]	24.4	0.7852
AT3G56190		ASNAP, ALPHA-SN...	alpha-soluble NSF attachment p...		Lus10002410 [exp]	34.3	0.7597
AT5G23850			Arabidopsis thaliana protein o...		Lus10008017 [exp]	41.0	0.7368
AT3G08720		ATPK2, ATPK19, ...	ARABIDOPSIS THALIANA SERINE/TH...		Lus10021386 [exp]	43.5	0.7743

Compare expression of checked genes

Lus10042928 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.