Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G61260 43 / 3e-06 Protein of unknown function (DUF761) (.1) AT2G26110 43 / 4e-06 Protein of unknown function (DUF761) (.1) AT4G14380 37 / 0.0003 unknown protein AT5G57510 37 / 0.0004 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G008160 [exp] 105 / 1e-31 AT2G26110 45 / 7e-07 Protein of unknown function (DUF761) (.1) Potri.003G217500 [exp] 90 / 1e-25 ND / Potri.003G217600 [exp] 56 / 4e-12 ND / Potri.001G171701 [exp] 42 / 1e-06 AT1G15385 53 / 7e-11 unknown protein Potri.003G062300 [exp] 42 / 3e-06 AT1G15385 58 / 8e-13 unknown protein Potri.001G406600 [exp] 42 / 8e-06 AT1G61260 192 / 1e-58 Protein of unknown function (DUF761) (.1) Potri.014G140000 [exp] 41 / 1e-05 AT5G47920 114 / 1e-31 unknown protein Potri.018G053000 [exp] 40 / 5e-05 AT2G26110 167 / 2e-49 Protein of unknown function (DUF761) (.1) Potri.011G044000 [exp] 39 / 9e-05 AT1G61260 227 / 7e-72 Protein of unknown function (DUF761) (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10019517 [exp] 42 / 1e-05 AT2G26110 148 / 5e-43 Protein of unknown function (DUF761) (.1) Lus10026978 [exp] 41 / 2e-05 AT2G26110 122 / 2e-33 Protein of unknown function (DUF761) (.1) Lus10000281 [exp] 40 / 4e-05 AT5G47920 76 / 5e-17 unknown protein Lus10024988 [exp] 39 / 0.0001 AT2G26110 172 / 1e-51 Protein of unknown function (DUF761) (.1) Lus10011239 [exp] 37 / 0.0006 AT1G11220 232 / 1e-73 Protein of unknown function (DUF761) (.1) Lus10042441 [exp] 36 / 0.001 AT5G57510 64 / 9e-14 unknown protein
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF05553 [poplar] [flax] DUF761 Cotton fibre expressed protein
Representative CDS sequence Show only first row Show all	>Potri.001G008080.1 pacid=42793527 polypeptide=Potri.001G008080.1.p locus=Potri.001G008080 ID=Potri.001G008080.1.v4.1 annot-version=v4.1 ATGGAACATAATAAAGAAGTTGCGAAGCATGATGATCTTAACATTAATGGCACGACAAGTGATGAAAGGAGGATAACAAGGATGCGAAACTGCAGGTTGG TTATGGAGGACGGTACTAGGGAAGATATAAATGAAAAAGCTGATGCTTTCATTAAGAACTTCCGCCATCAACTAAAGATTCAACGCCAAGACTCGCTCAA ACGCTTCCAGGAGAGGATCTCCCGGGGAGTTTAA
AA sequence Show only first row Show all	>Potri.001G008080.1 pacid=42793527 polypeptide=Potri.001G008080.1.p locus=Potri.001G008080 ID=Potri.001G008080.1.v4.1 annot-version=v4.1 MEHNKEVAKHDDLNINGTTSDERRITRMRNCRLVMEDGTREDINEKADAFIKNFRHQLKIQRQDSLKRFQERISRGV

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT2G26110			Protein of unknown function (D...		Potri.001G008080 [exp]	0	1
AT3G10080			RmlC-like cupins superfamily p...		Potri.010G238100 [exp]	1.41	0.9854
					Potri.002G122400 [exp]	1.73	0.9755
AT5G23960		ATTPS21	terpene synthase 21 (.1.2)		Potri.019G016900 [exp]	2.64	0.9550
AT1G63410			Protein of unknown function (D...		Potri.001G106300 [exp]	3.46	0.9598
AT4G08250	GRAS		GRAS family transcription fact...		Potri.005G190300 [exp]	6.63	0.9683	GRAS43
AT5G01750			Protein of unknown function (D...		Potri.016G130700 [exp]	7.74	0.9336
AT1G18350		ATMKK7, BUD1	MAP KINASE KINASE7, BUSHY AND ...		Potri.008G183700 [exp]	8.83	0.9406
AT3G07600			Heavy metal transport/detoxifi...		Potri.009G048400 [exp]	9.21	0.9634
AT5G42380		CML39, CML37	CALMODULIN LIKE 39, calmodulin...		Potri.002G132500 [exp]	11.61	0.9461
AT5G42650		CYP74A, AOS, DD...	DELAYED DEHISCENCE 2, CYTOCHRO...		Potri.014G038700 [exp]	12.24	0.9384

Compare expression of checked genes

Potri.001G008080 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.