Potri.001G071900 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT5G47890 145 / 8e-47 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.003G159100 169 / 3e-56 AT5G47890 152 / 1e-49 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
Potri.013G126200 38 / 0.0002 AT3G59650 202 / 8e-69 mitochondrial ribosomal protein L51/S25/CI-B8 family protein (.1.2)
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10011053 163 / 8e-54 AT5G47890 155 / 4e-51 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
Lus10003023 160 / 6e-53 AT5G47890 155 / 4e-51 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
Lus10040122 158 / 5e-52 AT5G47890 150 / 8e-49 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
Lus10030922 156 / 3e-51 AT5G47890 149 / 2e-48 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0172 Thioredoxin PF05047 L51_S25_CI-B8 Mitochondrial ribosomal protein L51 / S25 / CI-B8 domain
Representative CDS sequence
>Potri.001G071900.1 pacid=42790339 polypeptide=Potri.001G071900.1.p locus=Potri.001G071900 ID=Potri.001G071900.1.v4.1 annot-version=v4.1
ATGGCATGGAGAGGCCAACTTTCTAAGAATCTGAAAGAGCTTCGGATTCTTCTTTGTCAATCTTCTCCTTCAAGTTCATCTACTAGAACATTTATAGAGA
AGAATTACAAGGATCTGAAGACCCTTAACCCAAAACTTCCAATTCTGATCCGTGAATGCAATGGAATCGAGCCTCAGTTATGGGCAAGATATGATTTTGG
TGTTGAGCGGGGCGTTCGGTTGGAGGGTTTAAGTGAGGCGCAGATCTCGAAGGCCCTAGAAGAGCTTGGGAAAGTGGGTGCATCACTTAAAGGTTGA
AA sequence
>Potri.001G071900.1 pacid=42790339 polypeptide=Potri.001G071900.1.p locus=Potri.001G071900 ID=Potri.001G071900.1.v4.1 annot-version=v4.1
MAWRGQLSKNLKELRILLCQSSPSSSSTRTFIEKNYKDLKTLNPKLPILIRECNGIEPQLWARYDFGVERGVRLEGLSEAQISKALEELGKVGASLKG

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT5G47890 NADH-ubiquinone oxidoreductase... Potri.001G071900 0 1
AT5G47570 unknown protein Potri.001G122200 1.41 0.9392
AT4G30010 unknown protein Potri.018G142500 2.00 0.9174
AT5G27200 ACP5 acyl carrier protein 5 (.1) Potri.005G044800 2.64 0.9030 Pt-ACP1.1
AT4G34720 ATVHA-C1, AVA-P... VACUOLAR H+-PUMPING ATPASE C1,... Potri.004G163400 2.82 0.9122 AVAP5.1
AT5G07960 unknown protein Potri.015G056300 3.87 0.9098
AT5G55290 ATPase, V0 complex, subunit E ... Potri.011G092600 5.09 0.8856
AT1G19910 AVA-2PE, ATVHA-... VACUOLAR-TYPE H+ ATPASE C2, AT... Potri.002G082700 5.47 0.8880
AT5G02780 GSTL1 glutathione transferase lambda... Potri.010G214800 7.61 0.8511
AT1G77350 unknown protein Potri.019G066600 8.83 0.9088
AT1G76200 unknown protein Potri.002G012700 9.79 0.8868

Potri.001G071900 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.