Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G04160 58 / 9e-11 AIR3 AUXIN-INDUCED IN ROOT CULTURES 3, Subtilisin-like serine endopeptidase family protein (.1) AT5G67360 57 / 3e-10 ARA12 Subtilase family protein (.1) AT5G03620 53 / 6e-09 Subtilisin-like serine endopeptidase family protein (.1) AT1G20150 52 / 1e-08 Subtilisin-like serine endopeptidase family protein (.1) AT3G14240 50 / 4e-08 Subtilase family protein (.1) AT1G32940 50 / 5e-08 ATSBT3.5 Subtilase family protein (.1) AT5G45650 50 / 8e-08 subtilase family protein (.1) AT5G45640 50 / 9e-08 Subtilisin-like serine endopeptidase family protein (.1) AT1G66220 46 / 2e-06 Subtilase family protein (.1) AT3G14067 46 / 2e-06 Subtilase family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.003G118800 [exp] 117 / 2e-31 AT1G04110 585 / 0.0 STOMATAL DENSITY AND DISTRIBUTION, Subtilase family protein (.1) Potri.001G113700 [exp] 87 / 6e-21 AT1G04110 538 / 0.0 STOMATAL DENSITY AND DISTRIBUTION, Subtilase family protein (.1) Potri.003G118500 [exp] 84 / 9e-20 AT1G04110 557 / 0.0 STOMATAL DENSITY AND DISTRIBUTION, Subtilase family protein (.1) Potri.019G006570 [exp] 81 / 8e-19 AT1G04110 568 / 0.0 STOMATAL DENSITY AND DISTRIBUTION, Subtilase family protein (.1) Potri.003G118700 [exp] 72 / 1e-15 AT1G04110 585 / 0.0 STOMATAL DENSITY AND DISTRIBUTION, Subtilase family protein (.1) Potri.005G145300 [exp] 58 / 1e-10 AT5G67360 932 / 0.0 Subtilase family protein (.1) Potri.003G067000 [exp] 57 / 2e-10 AT3G14067 969 / 0.0 Subtilase family protein (.1) Potri.003G120101 [exp] 57 / 3e-10 AT5G59190 536 / 0.0 subtilase family protein (.1) Potri.014G171600 [exp] 57 / 3e-10 AT2G04160 986 / 0.0 AUXIN-INDUCED IN ROOT CULTURES 3, Subtilisin-like serine endopeptidase family protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10007046 [exp] 96 / 4e-24 AT1G04110 603 / 0.0 STOMATAL DENSITY AND DISTRIBUTION, Subtilase family protein (.1) Lus10006702 [exp] 96 / 4e-24 AT1G04110 596 / 0.0 STOMATAL DENSITY AND DISTRIBUTION, Subtilase family protein (.1) Lus10006704 [exp] 96 / 4e-24 AT1G04110 594 / 0.0 STOMATAL DENSITY AND DISTRIBUTION, Subtilase family protein (.1) Lus10002995 [exp] 91 / 5e-22 AT1G04110 584 / 0.0 STOMATAL DENSITY AND DISTRIBUTION, Subtilase family protein (.1) Lus10007045 [exp] 85 / 5e-20 AT1G04110 603 / 0.0 STOMATAL DENSITY AND DISTRIBUTION, Subtilase family protein (.1) Lus10006693 [exp] 81 / 2e-18 AT5G67360 563 / 0.0 Subtilase family protein (.1) Lus10007036 [exp] 80 / 3e-18 AT5G67360 564 / 0.0 Subtilase family protein (.1) Lus10007033 [exp] 76 / 6e-17 AT5G67360 551 / 0.0 Subtilase family protein (.1) Lus10028893 [exp] 76 / 7e-17 AT1G04110 580 / 0.0 STOMATAL DENSITY AND DISTRIBUTION, Subtilase family protein (.1) Lus10007044 [exp] 75 / 2e-16 AT1G04110 590 / 0.0 STOMATAL DENSITY AND DISTRIBUTION, Subtilase family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.001G113533.1 pacid=42791261 polypeptide=Potri.001G113533.1.p locus=Potri.001G113533 ID=Potri.001G113533.1.v4.1 annot-version=v4.1 ATGGCAGCCCAGCATAAACAAGAGGTAATACTGTTGAAGGGAAGTTGCTATGTAGGGAAGGAAAGAAATTCACCATCAATCTGTTCACCATTTCCAAGCT TTGCAGTAGCAACAATTCTTCTGTCTAGAGTGCTTGCTCCAACTGTTAGAATCCATGGAGCTTCATTAGATAATGTGATGTTAAAAGGGCCAGAATTTCC AGCTGCGCAGCTTACAAATATTCCCTTCTGTATGGCTGCAAATGAGCCTATGGAAACGCTATCCTCAAAGAATGGAACTGAATCTCCTCCAAGGGAAAGT GAGAGCACATCGACTCCATCTTGGACAGCTGCATCAGTGGTTAAGCAGAGCAGCAATGCCACTGAGAAGTGGGCAAGACATTGA
AA sequence Show only first row Show all	>Potri.001G113533.1 pacid=42791261 polypeptide=Potri.001G113533.1.p locus=Potri.001G113533 ID=Potri.001G113533.1.v4.1 annot-version=v4.1 MAAQHKQEVILLKGSCYVGKERNSPSICSPFPSFAVATILLSRVLAPTVRIHGASLDNVMLKGPEFPAAQLTNIPFCMAANEPMETLSSKNGTESPPRES ESTSTPSWTAASVVKQSSNATEKWARH

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT2G05920			Subtilase family protein (.1)		Potri.001G113533 [exp]	0	1
AT3G04280		ARR22	response regulator 22 (.1.2.3)		Potri.003G177300 [exp]	10.95	1.0000
					Potri.014G045150 [exp]	13.41	1.0000
AT5G45890		SAG12	senescence-associated gene 12 ...		Potri.013G118200 [exp]	14.00	0.9944
					Potri.019G036825 [exp]	14.14	1.0000
AT4G30880			Bifunctional inhibitor/lipid-t...		Potri.009G048900 [exp]	14.49	1.0000
AT3G58610			ketol-acid reductoisomerase (....		Potri.019G089366 [exp]	14.49	1.0000
AT1G32583			unknown protein		Potri.010G145501 [exp]	16.49	1.0000
AT1G43760			DNAse I-like superfamily prote...		Potri.014G188801 [exp]	18.70	0.9787
AT3G54940			Papain family cysteine proteas...		Potri.010G228400 [exp]	18.97	0.9556
					Potri.011G006000 [exp]	19.07	0.9271

Compare expression of checked genes

Potri.001G113533 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.