Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G15385 54 / 6e-11 unknown protein AT5G56980 42 / 2e-05 unknown protein AT1G61260 41 / 2e-05 Protein of unknown function (DUF761) (.1) AT5G54300 39 / 9e-05 Protein of unknown function (DUF761) (.1) AT4G16790 37 / 0.0006 hydroxyproline-rich glycoprotein family protein (.1) AT4G26130 37 / 0.0007 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.003G062300 [exp] 147 / 7e-48 AT1G15385 58 / 8e-13 unknown protein Potri.001G008160 [exp] 47 / 3e-08 AT2G26110 45 / 7e-07 Protein of unknown function (DUF761) (.1) Potri.018G053000 [exp] 45 / 6e-07 AT2G26110 167 / 2e-49 Protein of unknown function (DUF761) (.1) Potri.003G217600 [exp] 42 / 1e-06 ND / Potri.001G008080 [exp] 42 / 2e-06 AT2G26110 44 / 2e-06 Protein of unknown function (DUF761) (.1) Potri.006G152200 [exp] 42 / 9e-06 AT5G56980 103 / 2e-25 unknown protein Potri.003G217500 [exp] 39 / 4e-05 ND / Potri.001G406600 [exp] 40 / 6e-05 AT1G61260 192 / 1e-58 Protein of unknown function (DUF761) (.1) Potri.011G044000 [exp] 39 / 0.0001 AT1G61260 227 / 7e-72 Protein of unknown function (DUF761) (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10019517 [exp] 49 / 6e-08 AT2G26110 148 / 5e-43 Protein of unknown function (DUF761) (.1) Lus10026978 [exp] 48 / 9e-08 AT2G26110 122 / 2e-33 Protein of unknown function (DUF761) (.1) Lus10024988 [exp] 48 / 1e-07 AT2G26110 172 / 1e-51 Protein of unknown function (DUF761) (.1) Lus10000281 [exp] 40 / 4e-05 AT5G47920 76 / 5e-17 unknown protein Lus10002566 [exp] 40 / 8e-05 AT5G47920 79 / 3e-18 unknown protein Lus10011239 [exp] 37 / 0.0005 AT1G11220 232 / 1e-73 Protein of unknown function (DUF761) (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF05553 [poplar] [flax] DUF761 Cotton fibre expressed protein
Representative CDS sequence Show only first row Show all	>Potri.001G171701.1 pacid=42790921 polypeptide=Potri.001G171701.1.p locus=Potri.001G171701 ID=Potri.001G171701.1.v4.1 annot-version=v4.1 ATGAAGAACAACAGATCCATACCTCCTCAACACCAGGGCTCGACAACTTTCGAAGCAAGAAATAATGATTTTCATACTTGCAAACAGGATAGAGAAGCTG TGAGGTCTCATGCTGTGGAGAATAAAGCAACAAACAATAAGCTAGCAAGTAAACCATATCAAGACGTAGATGCAAGCGCTGAGGCATTCATCAAGAAATT CAGGCAACAACTTACGATCCAGAGGCTTGAATCCATTGAGAATTACGAGCAAATGGTGGCAAGAGGTCTCTAG
AA sequence Show only first row Show all	>Potri.001G171701.1 pacid=42790921 polypeptide=Potri.001G171701.1.p locus=Potri.001G171701 ID=Potri.001G171701.1.v4.1 annot-version=v4.1 MKNNRSIPPQHQGSTTFEARNNDFHTCKQDREAVRSHAVENKATNNKLASKPYQDVDASAEAFIKKFRQQLTIQRLESIENYEQMVARGL

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G15385			unknown protein		Potri.001G171701 [exp]	0	1
AT1G29640			Protein of unknown function, D...		Potri.011G076900 [exp]	6.32	0.9818
					Potri.003G165550 [exp]	12.96	0.9824
AT1G52565			unknown protein		Potri.001G192800 [exp]	13.71	0.9831
AT5G48100		LAC15, TT10, AT...	TRANSPARENT TESTA 10, LACCASE-...		Potri.005G200600 [exp]	23.74	0.9760
AT1G68840	AP2_ERF	EDF2, RAV2, RAP...	TEMPRANILLO 2, RELATED TO AP2 ...		Potri.003G010700 [exp]	28.72	0.9800
AT4G16260			Glycosyl hydrolase superfamily...		Potri.001G255100 [exp]	28.98	0.9797	Pt-GNS1.4
AT2G47180		ATGOLS1	galactinol synthase 1 (.1)		Potri.008G101000 [exp]	32.83	0.9751	Pt-GAS1.1
AT3G25830		ATTPS-CIN	"terpene synthase-like sequenc...		Potri.011G031800 [exp]	33.80	0.9787
AT5G06740			Concanavalin A-like lectin pro...		Potri.004G209300 [exp]	35.59	0.9795
AT4G15480		UGT84A1	UDP-Glycosyltransferase superf...		Potri.009G095300 [exp]	38.60	0.9787

Compare expression of checked genes

Potri.001G171701 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.