Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G72770 114 / 2e-31 HAB1 HYPERSENSITIVE TO ABA1, homology to ABI1 (.1.2.3) AT1G17550 100 / 1e-26 HAB2 homology to ABI2 (.1) AT5G57050 91 / 2e-23 AtABI2, ABI2 ABA INSENSITIVE 2, Protein phosphatase 2C family protein (.1.2) AT4G26080 89 / 3e-22 AtABI1, ABI1 ABA INSENSITIVE 1, Protein phosphatase 2C family protein (.1) AT2G29380 51 / 5e-09 HAI3 highly ABA-induced PP2C gene 3 (.1) AT3G11410 50 / 1e-08 ATPP2CA, AHG3 ARABIDOPSIS THALIANA PROTEIN PHOSPHATASE 2CA, protein phosphatase 2CA (.1) AT5G59220 47 / 2e-07 SAG113, HAI1 senescence associated gene 113, highly ABA-induced PP2C gene 1 (.1) AT5G51760 47 / 2e-07 AHG1 ABA-hypersensitive germination 1, Protein phosphatase 2C family protein (.1) AT1G07430 44 / 2e-06 HAI2 highly ABA-induced PP2C gene 2 (.1) AT2G30020 44 / 2e-06 Protein phosphatase 2C family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.003G044200 [exp] 127 / 6e-36 AT1G72770 576 / 0.0 HYPERSENSITIVE TO ABA1, homology to ABI1 (.1.2.3) Potri.006G224600 [exp] 109 / 1e-29 AT1G72770 503 / 1e-174 HYPERSENSITIVE TO ABA1, homology to ABI1 (.1.2.3) Potri.018G060300 [exp] 108 / 3e-29 AT1G72770 493 / 8e-171 HYPERSENSITIVE TO ABA1, homology to ABI1 (.1.2.3) Potri.006G164632 [exp] 51 / 6e-09 AT4G26080 300 / 1e-98 ABA INSENSITIVE 1, Protein phosphatase 2C family protein (.1) Potri.001G245200 [exp] 49 / 3e-08 AT2G29380 410 / 5e-142 highly ABA-induced PP2C gene 3 (.1) Potri.009G037300 [exp] 49 / 4e-08 AT1G07430 401 / 2e-137 highly ABA-induced PP2C gene 2 (.1) Potri.008G059200 [exp] 49 / 4e-08 AT1G07430 362 / 1e-122 highly ABA-induced PP2C gene 2 (.1) Potri.012G131800 [exp] 49 / 5e-08 AT5G51760 332 / 3e-111 ABA-hypersensitive germination 1, Protein phosphatase 2C family protein (.1) Potri.015G018800 [exp] 48 / 9e-08 AT1G07430 236 / 2e-74 highly ABA-induced PP2C gene 2 (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10025000 [exp] 98 / 2e-25 AT1G72770 467 / 1e-160 HYPERSENSITIVE TO ABA1, homology to ABI1 (.1.2.3) Lus10026447 [exp] 97 / 4e-25 AT1G72770 465 / 1e-159 HYPERSENSITIVE TO ABA1, homology to ABI1 (.1.2.3) Lus10016493 [exp] 50 / 1e-08 AT1G07430 421 / 2e-145 highly ABA-induced PP2C gene 2 (.1) Lus10019017 [exp] 50 / 1e-08 AT2G29380 280 / 3e-92 highly ABA-induced PP2C gene 3 (.1) Lus10040738 [exp] 50 / 2e-08 AT1G07430 429 / 7e-148 highly ABA-induced PP2C gene 2 (.1) Lus10003399 [exp] 49 / 3e-08 AT2G29380 252 / 2e-82 highly ABA-induced PP2C gene 3 (.1) Lus10034965 [exp] 48 / 7e-08 AT1G72770 249 / 3e-79 HYPERSENSITIVE TO ABA1, homology to ABI1 (.1.2.3) Lus10040270 [exp] 48 / 9e-08 AT2G29380 390 / 1e-134 highly ABA-induced PP2C gene 3 (.1) Lus10004703 [exp] 47 / 1e-07 AT2G29380 392 / 3e-135 highly ABA-induced PP2C gene 3 (.1) Lus10012962 [exp] 46 / 5e-07 AT4G26080 315 / 2e-104 ABA INSENSITIVE 1, Protein phosphatase 2C family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0238 [poplar] [flax] PP2C PF00481 [poplar] [flax] PP2C Protein phosphatase 2C
Representative CDS sequence Show only first row Show all	>Potri.001G198400.2 pacid=42788368 polypeptide=Potri.001G198400.2.p locus=Potri.001G198400 ID=Potri.001G198400.2.v4.1 annot-version=v4.1 ATGTTTATTCCTCGTGCTAGAGATGATGAATGCCTTATTTTAGCTAGTGATGGATTATGGGATGTTATTACAAATGAGGAAGCCTGTGAAGTGGCTCGAC CGCGGATTCTGTTATGGCACAAAAAGAATGGGGTTGCATCTCTTCTTGAAAGGGGAAAAGGTACAGATCCTGCAGCTCAAGCAGCGGCTGATTACCAGCG GCTGATTACCTTTCAATGCTTGCCCTCCAGAAGGGAAGCAAGGATAATATCTCTGTGA
AA sequence Show only first row Show all	>Potri.001G198400.2 pacid=42788368 polypeptide=Potri.001G198400.2.p locus=Potri.001G198400 ID=Potri.001G198400.2.v4.1 annot-version=v4.1 MFIPRARDDECLILASDGLWDVITNEEACEVARPRILLWHKKNGVASLLERGKGTDPAAQAAADYQRLITFQCLPSRREARIISL

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G72770		HAB1	HYPERSENSITIVE TO ABA1, homolo...		Potri.001G198400 [exp]	0	1
AT2G37980			O-fucosyltransferase family pr...		Potri.006G095300 [exp]	5.29	0.8967
AT4G36760		ATAPP1	ARABIDOPSIS THALIANA AMINOPEPT...		Potri.018G145584 [exp]	5.29	0.8313
AT5G02640			unknown protein		Potri.006G215000 [exp]	11.22	0.8231
AT1G15320			unknown protein		Potri.001G202300 [exp]	12.40	0.8638
AT5G62740		AtHIR4, ATHIR1	hypersensitive induced reactio...		Potri.015G065001 [exp]	12.48	0.8723
AT4G19110			Protein kinase superfamily pro...		Potri.003G190200 [exp]	28.56	0.8424
AT5G04420			Galactose oxidase/kelch repeat...		Potri.008G030901 [exp]	35.62	0.8557
AT5G07610			F-box family protein (.1)		Potri.001G146000 [exp]	36.98	0.8132
AT1G46480	HD	WOX4	WUSCHEL related homeobox 4 (.1...		Potri.002G124100 [exp]	43.84	0.8307
AT1G61667			Protein of unknown function, D...		Potri.011G032600 [exp]	44.69	0.8170

Compare expression of checked genes

Potri.001G198400 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.