Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol	PtrGrx11
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G02000 155 / 6e-50 ROXY1 Thioredoxin superfamily protein (.1) AT5G14070 154 / 1e-49 ROXY2 Thioredoxin superfamily protein (.1) AT4G15700 130 / 2e-40 Thioredoxin superfamily protein (.1) AT4G15670 129 / 5e-40 Thioredoxin superfamily protein (.1) AT4G15660 128 / 9e-40 Thioredoxin superfamily protein (.1) AT4G15680 128 / 1e-39 Thioredoxin superfamily protein (.1) AT2G47870 125 / 1e-38 Thioredoxin superfamily protein (.1) AT4G15690 125 / 1e-38 Thioredoxin superfamily protein (.1) AT5G18600 124 / 6e-38 Thioredoxin superfamily protein (.1) AT3G21460 122 / 3e-37 Glutaredoxin family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G060600 [exp] 216 / 4e-74 AT5G14070 147 / 1e-46 Thioredoxin superfamily protein (.1) Potri.003G167000 [exp] 211 / 2e-72 AT5G14070 150 / 9e-48 Thioredoxin superfamily protein (.1) Potri.008G214500 [exp] 141 / 8e-45 AT3G21460 177 / 2e-59 Glutaredoxin family protein (.1) Potri.010G021800 [exp] 127 / 3e-39 AT5G18600 163 / 5e-54 Thioredoxin superfamily protein (.1) Potri.008G214600 [exp] 122 / 4e-37 AT5G18600 159 / 2e-52 Thioredoxin superfamily protein (.1) Potri.008G214800 [exp] 119 / 2e-36 AT5G18600 157 / 2e-51 Thioredoxin superfamily protein (.1) Potri.002G208400 [exp] 118 / 1e-35 AT2G30540 160 / 8e-53 Thioredoxin superfamily protein (.1) Potri.014G134000 [exp] 113 / 7e-34 AT3G62930 158 / 8e-52 Thioredoxin superfamily protein (.1) Potri.014G133900 [exp] 111 / 7e-33 AT3G62930 141 / 4e-45 Thioredoxin superfamily protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10011333 [exp] 176 / 8e-58 AT5G14070 151 / 1e-47 Thioredoxin superfamily protein (.1) Lus10035183 [exp] 172 / 1e-56 AT5G14070 148 / 6e-47 Thioredoxin superfamily protein (.1) Lus10041538 [exp] 157 / 8e-51 AT5G14070 134 / 3e-41 Thioredoxin superfamily protein (.1) Lus10012815 [exp] 133 / 2e-41 AT3G21460 171 / 3e-57 Glutaredoxin family protein (.1) Lus10033965 [exp] 127 / 2e-39 AT5G18600 148 / 5e-48 Thioredoxin superfamily protein (.1) Lus10002887 [exp] 126 / 1e-38 AT4G15690 149 / 3e-48 Thioredoxin superfamily protein (.1) Lus10013962 [exp] 118 / 2e-35 AT1G28480 135 / 3e-42 Thioredoxin superfamily protein (.1) Lus10040899 [exp] 116 / 5e-35 AT2G30540 140 / 5e-45 Thioredoxin superfamily protein (.1) Lus10023295 [exp] 116 / 2e-34 AT5G14070 123 / 5e-37 Thioredoxin superfamily protein (.1) Lus10005937 [exp] 113 / 8e-34 AT2G47880 138 / 7e-44 Glutaredoxin family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0172 [poplar] [flax] Thioredoxin PF00462 [poplar] [flax] Glutaredoxin Glutaredoxin
Representative CDS sequence Show only first row Show all	>Potri.001G325800.1 pacid=42789717 polypeptide=Potri.001G325800.1.p locus=Potri.001G325800 ID=Potri.001G325800.1.v4.1 annot-version=v4.1 ATGTATCAAACCGAGTCATGGGGGTCTTACATGCCAGCAAGAACCAACCTTGGTGACCCATTGGAACGCATAGGAAGGCTAGCCTCAGAGAATGCAGTGG TGATCTTTAGCATAAGCTCATGTTGCATGTGCCATGCTATTAAGAGGCTCTTTTGTGGCATGGGAGTGAACCCAACAGTGTACGAGCTGGATGAAGACCC AAGAGGTAAAGAAATGGAGAAGGCTCTCATGAGGCTTCTCGGTAGCTCCTCTGCTGTTCCTGTTGTTTTCATCGGTGGCAAGCTTGTGGGTGCCATGGAT AGAGTCATGGCTTCTCATATTAACGGTACTCTTGTCCCTCTTCTCAAGGAAGCCGGTGCTCTTTGGCTTTAA
AA sequence Show only first row Show all	>Potri.001G325800.1 pacid=42789717 polypeptide=Potri.001G325800.1.p locus=Potri.001G325800 ID=Potri.001G325800.1.v4.1 annot-version=v4.1 MYQTESWGSYMPARTNLGDPLERIGRLASENAVVIFSISSCCMCHAIKRLFCGMGVNPTVYELDEDPRGKEMEKALMRLLGSSSAVPVVFIGGKLVGAMD RVMASHINGTLVPLLKEAGALWL

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G02000		ROXY1	Thioredoxin superfamily protei...		Potri.001G325800 [exp]	0	1	PtrGrx11
AT1G32250			Calcium-binding EF-hand family...		Potri.014G030200 [exp]	13.56	0.9110
AT3G28455		CLE25	CLAVATA3/ESR-RELATED 25 (.1)		Potri.014G021250 [exp]	16.73	0.9044
					Potri.007G034000 [exp]	18.76	0.9045
					Potri.007G034101 [exp]	23.23	0.9042
AT3G30340			nodulin MtN21 /EamA-like trans...		Potri.014G108500 [exp]	25.92	0.9026
					Potri.005G168401 [exp]	30.00	0.9013
AT3G16360		AHP4	HPT phosphotransmitter 4 (.1.2...		Potri.001G189900 [exp]	33.00	0.9005
AT2G42610		LSH10	LIGHT SENSITIVE HYPOCOTYLS 10,...		Potri.011G066400 [exp]	33.00	0.8191
AT2G43290		MSS3	multicopy suppressors of snf4 ...		Potri.008G079066 [exp]	34.11	0.8974
AT4G08300			nodulin MtN21 /EamA-like trans...		Potri.005G176200 [exp]	35.51	0.8973

Compare expression of checked genes

Potri.001G325800 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.