Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G45010 37 / 0.0001 DSS1(V), ATDSS1(V), DSS1(V), ATDSS1(V), DSS1(V), ATDSS1(V), DSS1(V), ATDSS1(V), DSS1(V), ATDSS1(V), DSS1 homolog on chromosome V (.1) AT1G64750 35 / 0.0004 DSS1(I), ATDSS1(I), DSS1(I), ATDSS1(I), DSS1(I), ATDSS1(I), DSS1(I), ATDSS1(I), DSS1(I), ATDSS1(I), deletion of SUV3 suppressor 1(I) (.1), deletion of SUV3 suppressor 1(I) (.2), deletion of SUV3 suppressor 1(I) (.3)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.017G066900 [exp] 50 / 1e-09 AT1G64750 50 / 7e-10 deletion of SUV3 suppressor 1(I) (.1), deletion of SUV3 suppressor 1(I) (.2), deletion of SUV3 suppressor 1(I) (.3)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10013049 [exp] 45 / 4e-08 AT1G64750 49 / 1e-09 deletion of SUV3 suppressor 1(I) (.1), deletion of SUV3 suppressor 1(I) (.2), deletion of SUV3 suppressor 1(I) (.3) Lus10030906 [exp] 39 / 1e-05 AT1G64750 47 / 1e-08 deletion of SUV3 suppressor 1(I) (.1), deletion of SUV3 suppressor 1(I) (.2), deletion of SUV3 suppressor 1(I) (.3) Lus10030583 [exp] 39 / 1e-05 AT1G64750 47 / 9e-09 deletion of SUV3 suppressor 1(I) (.1), deletion of SUV3 suppressor 1(I) (.2), deletion of SUV3 suppressor 1(I) (.3) Lus10029113 [exp] 41 / 2e-05 AT1G68940 572 / 0.0 Armadillo/beta-catenin-like repeat family protein (.1.2.3)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF05160 [poplar] [flax] DSS1_SEM1 DSS1/SEM1 family
Representative CDS sequence Show only first row Show all	>Potri.001G334600.1 pacid=42790194 polypeptide=Potri.001G334600.1.p locus=Potri.001G334600 ID=Potri.001G334600.1.v4.1 annot-version=v4.1 ATGGCAACTGAACCGAAACCTGCAACTGAGGATGTGAAGATTGACTTGTTCGAGGATGATGATGAATTTGAAGAATTTGAAATCAATGAAGAGTGGAAAG AGAAGGAGGAAGGGAAAGAGGTGACACAGCAGTGGGAGGATGATTGGGATGATGATGATGTCAATGATGACTTCTCACTGCAGCTGAAAAAGGAATTGGA GAACACACCAAAGAACTGA
AA sequence Show only first row Show all	>Potri.001G334600.1 pacid=42790194 polypeptide=Potri.001G334600.1.p locus=Potri.001G334600 ID=Potri.001G334600.1.v4.1 annot-version=v4.1 MATEPKPATEDVKIDLFEDDDEFEEFEINEEWKEKEEGKEVTQQWEDDWDDDDVNDDFSLQLKKELENTPKN

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G64750		DSS1(I), ATDSS1...	deletion of SUV3 suppressor 1(...		Potri.001G334600 [exp]	0	1
AT1G22270			Trm112p-like protein (.1)		Potri.005G165000 [exp]	4.35	0.7762
AT1G51060		HTA10	histone H2A 10 (.1)		Potri.011G131400 [exp]	6.16	0.7346	HTA901
AT2G37410		ATTIM17-2	TRANSLOCASE OF THE INNER MEMBR...		Potri.008G176500 [exp]	7.21	0.7203	TIM17.2
AT3G07910			unknown protein		Potri.001G277100 [exp]	7.74	0.6934
AT1G03150			Acyl-CoA N-acyltransferases (N...		Potri.005G210400 [exp]	8.94	0.7127	SGB903
AT1G27435			unknown protein		Potri.001G325000 [exp]	18.81	0.7207
AT3G62600		ATERDJ3B	DNAJ heat shock family protein...		Potri.014G122600 [exp]	18.97	0.6316
AT5G59890		ADF4, ATADF4	actin depolymerizing factor 4 ...		Potri.010G208500 [exp]	20.85	0.6380
AT5G05710			Pleckstrin homology (PH) domai...		Potri.008G066700 [exp]	21.97	0.6243
AT2G46800		ATMTP1, ZAT1, Z...	ZINC TRANSPORTER OF ARABIDOPSI...		Potri.001G450900 [exp]	22.97	0.6437

Compare expression of checked genes

Potri.001G334600 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.