Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G18880 71 / 2e-15 NRT1.9 nitrate transporter 1.9, Major facilitator superfamily protein (.1) AT1G22540 69 / 4e-15 Major facilitator superfamily protein (.1) AT1G69870 69 / 4e-15 NRT1.7 nitrate transporter 1.7 (.1) AT1G72140 67 / 4e-14 Major facilitator superfamily protein (.1) AT1G72130 66 / 8e-14 Major facilitator superfamily protein (.1.2) AT3G54450 57 / 9e-11 Major facilitator superfamily protein (.1) AT3G53960 57 / 1e-10 Major facilitator superfamily protein (.1) AT1G72120 56 / 3e-10 Major facilitator superfamily protein (.1) AT1G22550 55 / 4e-10 Major facilitator superfamily protein (.1) AT1G33440 54 / 2e-09 Major facilitator superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.012G071500 [exp] 88 / 1e-21 AT5G62680 779 / 0.0 Major facilitator superfamily protein (.1) Potri.001G351200 [exp] 68 / 1e-14 AT5G62680 677 / 0.0 Major facilitator superfamily protein (.1) Potri.012G071400 [exp] 67 / 3e-14 AT5G62680 689 / 0.0 Major facilitator superfamily protein (.1) Potri.019G079551 [exp] 67 / 5e-14 AT1G22540 662 / 0.0 Major facilitator superfamily protein (.1) Potri.017G076800 [exp] 66 / 8e-14 AT3G47960 680 / 0.0 Major facilitator superfamily protein (.1) Potri.013G106925 [exp] 64 / 5e-13 AT1G22540 605 / 0.0 Major facilitator superfamily protein (.1) Potri.013G106600 [exp] 63 / 7e-13 AT1G22540 666 / 0.0 Major facilitator superfamily protein (.1) Potri.010G034700 [exp] 62 / 2e-12 AT1G69870 702 / 0.0 nitrate transporter 1.7 (.1) Potri.013G106700 [exp] 61 / 6e-12 AT1G22540 612 / 0.0 Major facilitator superfamily protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10015351 [exp] 69 / 9e-15 AT1G18880 682 / 0.0 nitrate transporter 1.9, Major facilitator superfamily protein (.1) Lus10036669 [exp] 66 / 1e-13 AT5G62680 758 / 0.0 Major facilitator superfamily protein (.1) Lus10033106 [exp] 66 / 1e-13 AT5G62680 761 / 0.0 Major facilitator superfamily protein (.1) Lus10036705 [exp] 64 / 6e-13 AT1G69870 709 / 0.0 nitrate transporter 1.7 (.1) Lus10037221 [exp] 63 / 7e-13 AT1G69870 709 / 0.0 nitrate transporter 1.7 (.1) Lus10016932 [exp] 60 / 8e-12 AT1G22540 673 / 0.0 Major facilitator superfamily protein (.1) Lus10039521 [exp] 60 / 1e-11 AT3G54450 612 / 0.0 Major facilitator superfamily protein (.1) Lus10008252 [exp] 59 / 2e-11 AT1G22540 641 / 0.0 Major facilitator superfamily protein (.1) Lus10037217 [exp] 59 / 4e-11 AT1G69850 813 / 0.0 nitrate transporter 1:2 (.1) Lus10036710 [exp] 58 / 5e-11 AT1G69850 822 / 0.0 nitrate transporter 1:2 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0015 [poplar] [flax] MFS PF00854 [poplar] [flax] PTR2 POT family
Representative CDS sequence Show only first row Show all	>Potri.001G376966.1 pacid=42787962 polypeptide=Potri.001G376966.1.p locus=Potri.001G376966 ID=Potri.001G376966.1.v4.1 annot-version=v4.1 ATGCTAAGTTTAAGCATTTTCATATCTATCTATGACCGGATTTTTGTCCCTTTTCTGCGAAGGATTACAGTTAAAGAAGGTGGCATCACGATCCTTCAAA GAATCGGCACTGGCATCTTTCTCACCATTGCAGCAATGTTAGTCTCTGGCTTAATTAGTCGAAGAGAAGCAAGGGACTATAGCTCTTACCAAGCCGACTC TAGGAAATGCACAAAGAAGAGGTGCCATCTGATCAATGTCGGCTTTATGGTTAACTCTTCCGCTATCTCTAGCAGGAACAGCAGAGGCATTTGGTTCCAT TGGACAGACTGA
AA sequence Show only first row Show all	>Potri.001G376966.1 pacid=42787962 polypeptide=Potri.001G376966.1.p locus=Potri.001G376966 ID=Potri.001G376966.1.v4.1 annot-version=v4.1 MLSLSIFISIYDRIFVPFLRRITVKEGGITILQRIGTGIFLTIAAMLVSGLISRREARDYSSYQADSRKCTKKRCHLINVGFMVNSSAISSRNSRGIWFH WTD

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G62680			Major facilitator superfamily ...		Potri.001G376966 [exp]	0	1
					Potri.003G076700 [exp]	3.16	0.8925
AT5G14750	MYB	WER1, WER, AtMY...	WEREWOLF 1, WEREWOLF, myb doma...		Potri.015G075800 [exp]	6.32	0.8409
					Potri.011G020275 [exp]	8.94	0.8532
AT2G29125		RTFL2, DVL13	DEVIL 13, ROTUNDIFOLIA like 2 ...		Potri.009G034300 [exp]	13.67	0.8298
					Potri.017G124901 [exp]	18.89	0.8137
AT4G34760			SAUR-like auxin-responsive pro...		Potri.004G164400 [exp]	19.18	0.7892	SAUR29
AT2G36870		XTH32	xyloglucan endotransglucosylas...		Potri.016G098600 [exp]	20.49	0.8333	XTH32.2
AT5G43250	CCAAT	NF-YC13	"nuclear factor Y, subunit C13...		Potri.001G055000 [exp]	24.65	0.8181
					Potri.012G031250 [exp]	25.39	0.8200
AT4G39010		ATGH9B18	glycosyl hydrolase 9B18 (.1)		Potri.004G162200 [exp]	27.05	0.8584

Compare expression of checked genes

Potri.001G376966 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.