Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G28360 64 / 1e-13 ABCB16, PGP16 ATP-binding cassette B16, P-glycoprotein 16 (.1) AT3G28415 61 / 2e-12 ABCB22 ATP-binding cassette B22, ABC transporter family protein (.1) AT2G47000 60 / 3e-12 PGP4 ,MDR4, ABCB4, ATPGP4 MULTIDRUG RESISTANCE 4, ARABIDOPSIS P-GLYCOPROTEIN 4, ATP-binding cassette B4, ATP binding cassette subfamily B4 (.1) AT3G62150 60 / 3e-12 ABCB21, PGP21 ATP-binding cassette B21, P-glycoprotein 21 (.1) AT1G02520 58 / 2e-11 MDR8, ABCB11, PGP11 multi-drug resistance 8, ATP-binding cassette B11, P-glycoprotein 11 (.1) AT3G28390 57 / 2e-11 ABCB18, PGP18 ATP-binding cassette B18, P-glycoprotein 18 (.1) AT1G27940 57 / 3e-11 ABCB13, PGP13 ATP-binding cassette B13, P-glycoprotein 13 (.1) AT1G10680 57 / 3e-11 ABCB10, PGP10 ATP-binding cassette B10, P-glycoprotein 10 (.1) AT1G02530 56 / 5e-11 ABCB12, PGP12 ATP-binding cassette B12, P-glycoprotein 12 (.1) AT4G01830 56 / 7e-11 ABCB5, PGP5 ATP-binding cassette B5, P-glycoprotein 5 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.011G133800 [exp] 91 / 4e-23 AT3G28345 1268 / 0.0 multi-drug resistance 13, ATP-binding cassette B15, ABC transporter family protein (.1) Potri.001G417600 [exp] 91 / 4e-23 AT3G28345 1241 / 0.0 multi-drug resistance 13, ATP-binding cassette B15, ABC transporter family protein (.1) Potri.006G074101 [exp] 70 / 9e-16 AT3G28345 1231 / 0.0 multi-drug resistance 13, ATP-binding cassette B15, ABC transporter family protein (.1) Potri.006G074400 [exp] 67 / 6e-15 AT3G28345 1243 / 0.0 multi-drug resistance 13, ATP-binding cassette B15, ABC transporter family protein (.1) Potri.018G141300 [exp] 66 / 3e-14 AT3G28345 1093 / 0.0 multi-drug resistance 13, ATP-binding cassette B15, ABC transporter family protein (.1) Potri.017G085000 [exp] 63 / 2e-13 AT3G28345 1774 / 0.0 multi-drug resistance 13, ATP-binding cassette B15, ABC transporter family protein (.1) Potri.017G074000 [exp] 62 / 4e-13 AT3G28345 1831 / 0.0 multi-drug resistance 13, ATP-binding cassette B15, ABC transporter family protein (.1) Potri.018G087100 [exp] 62 / 7e-13 AT3G28345 1259 / 0.0 multi-drug resistance 13, ATP-binding cassette B15, ABC transporter family protein (.1) Potri.002G019600 [exp] 58 / 1e-11 AT1G27940 1654 / 0.0 ATP-binding cassette B13, P-glycoprotein 13 (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10036616 [exp] 84 / 7e-21 AT3G28345 479 / 6e-159 multi-drug resistance 13, ATP-binding cassette B15, ABC transporter family protein (.1) Lus10035834 [exp] 84 / 9e-21 AT3G28345 1271 / 0.0 multi-drug resistance 13, ATP-binding cassette B15, ABC transporter family protein (.1) Lus10043069 [exp] 81 / 2e-19 AT3G28390 1232 / 0.0 ATP-binding cassette B18, P-glycoprotein 18 (.1) Lus10024162 [exp] 69 / 1e-15 AT3G28345 1280 / 0.0 multi-drug resistance 13, ATP-binding cassette B15, ABC transporter family protein (.1) Lus10039533 [exp] 69 / 1e-15 AT3G28345 1288 / 0.0 multi-drug resistance 13, ATP-binding cassette B15, ABC transporter family protein (.1) Lus10041565 [exp] 64 / 1e-13 AT3G28345 1804 / 0.0 multi-drug resistance 13, ATP-binding cassette B15, ABC transporter family protein (.1) Lus10038049 [exp] 62 / 9e-13 AT3G62150 1891 / 0.0 ATP-binding cassette B21, P-glycoprotein 21 (.1) Lus10000052 [exp] 59 / 2e-12 AT3G62150 284 / 2e-89 ATP-binding cassette B21, P-glycoprotein 21 (.1) Lus10010012 [exp] 60 / 4e-12 AT1G02520 1526 / 0.0 multi-drug resistance 8, ATP-binding cassette B11, P-glycoprotein 11 (.1) Lus10004519 [exp] 59 / 5e-12 AT1G02520 636 / 0.0 multi-drug resistance 8, ATP-binding cassette B11, P-glycoprotein 11 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0023 [poplar] [flax] P-loop_NTPase PF00005 [poplar] [flax] ABC_tran ABC transporter
Representative CDS sequence Show only first row Show all	>Potri.001G417801.1 pacid=42792634 polypeptide=Potri.001G417801.1.p locus=Potri.001G417801 ID=Potri.001G417801.1.v4.1 annot-version=v4.1 ATGGTAGAGGATGCAAGAGAATCTGAGATACGAAAGGCTGCAGTTCTTGCTACTGCACAAGAATTTATCAGTGGAATGAAAGATGGGTATGATACCTACT GTGGAGAAAGAGGATTTCAGCTATCAGGAGGTCAAAAACAAGGGCTTGCACTTGCTGGTGCAATCCTGAAGGATCTATCAATCCTGTTGTTGGACGAGGC AACCAGCACTTGA
AA sequence Show only first row Show all	>Potri.001G417801.1 pacid=42792634 polypeptide=Potri.001G417801.1.p locus=Potri.001G417801 ID=Potri.001G417801.1.v4.1 annot-version=v4.1 MVEDARESEIRKAAVLATAQEFISGMKDGYDTYCGERGFQLSGGQKQGLALAGAILKDLSILLLDEATST

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G28360		ABCB16, PGP16	ATP-binding cassette B16, P-gl...		Potri.001G417801 [exp]	0	1
AT1G47750		PEX11A	peroxin 11A (.1)		Potri.002G134000 [exp]	1.41	0.8617
AT1G26690			emp24/gp25L/p24 family/GOLD fa...		Potri.004G127200 [exp]	2.44	0.8560
AT3G54190			Transducin/WD40 repeat-like su...		Potri.013G091800 [exp]	5.83	0.7551
AT3G46210			Ribosomal protein S5 domain 2-...		Potri.006G239100 [exp]	8.12	0.8368
					Potri.001G152550 [exp]	11.53	0.7781
AT5G06900		CYP93D1	"cytochrome P450, family 93, s...		Potri.008G082301 [exp]	11.83	0.8449
AT4G20960			Cytidine/deoxycytidylate deami...		Potri.002G158800 [exp]	14.00	0.7657
AT4G14300			RNA-binding (RRM/RBD/RNP motif...		Potri.014G195300 [exp]	16.73	0.8226
AT1G79750		ATNADP-ME4	Arabidopsis thaliana NADP-mali...		Potri.003G049300 [exp]	16.91	0.7938
AT1G11750		NCLPP6, NCLPP1,...	NUCLEAR-ENCODED CLPP 1, CLP pr...		Potri.009G114001 [exp]	17.43	0.8302

Compare expression of checked genes

Potri.001G417801 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.