Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol	SRP9.2
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G49100 199 / 5e-68 Signal recognition particle, SRP9/SRP14 subunit (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.005G219400 [exp] 200 / 2e-68 AT3G49100 177 / 3e-59 Signal recognition particle, SRP9/SRP14 subunit (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10018775 [exp] 190 / 8e-64 AT3G49100 194 / 2e-65 Signal recognition particle, SRP9/SRP14 subunit (.1) Lus10024862 [exp] 186 / 2e-62 AT3G49100 193 / 3e-65 Signal recognition particle, SRP9/SRP14 subunit (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0623 [poplar] [flax] SRP9_14 PF05486 [poplar] [flax] SRP9-21 Signal recognition particle 9 kDa protein (SRP9)
Representative CDS sequence Show only first row Show all	>Potri.002G043600.1 pacid=42776985 polypeptide=Potri.002G043600.1.p locus=Potri.002G043600 ID=Potri.002G043600.1.v4.1 annot-version=v4.1 ATGGTTTACATGGCTTCATGGGACGAGTTCGTTGAGCGATCCGTACAGTTGTTCCGTGCCGATCCTGATTCTACTCGGTATGTCATGAAGTACAGACACT GTGATGGCAAGTTGGTTCTCAAGGTCACTGACAACAAAGAGTGTCTTAAGTTCAAGACAGACCAGGCACAGGATGCTAAGAAGATGGAGAAGCTAAACAA CCAATTTTTTACTTTGATGTCTCGGGGCCCTGATGCGGATCTGTCGGAAGTTACAGGGAAAGAACAGACAGAAGCACAGCCAGGGAAGAAAGGGAGGGGA AGGAAACAATAA
AA sequence Show only first row Show all	>Potri.002G043600.1 pacid=42776985 polypeptide=Potri.002G043600.1.p locus=Potri.002G043600 ID=Potri.002G043600.1.v4.1 annot-version=v4.1 MVYMASWDEFVERSVQLFRADPDSTRYVMKYRHCDGKLVLKVTDNKECLKFKTDQAQDAKKMEKLNNQFFTLMSRGPDADLSEVTGKEQTEAQPGKKGRG RKQ

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G49100			Signal recognition particle, S...		Potri.002G043600 [exp]	0	1	SRP9.2
AT5G14030			translocon-associated protein ...		Potri.017G061900 [exp]	7.34	0.8906
AT5G50460			secE/sec61-gamma protein trans...		Potri.015G097300 [exp]	8.71	0.8577	SEC61.2
AT4G38500			Protein of unknown function (D...		Potri.004G177600 [exp]	17.49	0.8300
AT5G44710			unknown protein		Potri.003G155000 [exp]	17.88	0.8538
AT2G21870		MGP1	MALE GAMETOPHYTE DEFECTIVE 1, ...		Potri.005G085500 [exp]	19.64	0.8649
AT3G52730			ubiquinol-cytochrome C reducta...		Potri.004G188700 [exp]	21.49	0.8499
AT1G42480			unknown protein		Potri.005G253600 [exp]	21.97	0.8640
AT5G40600		EMB1875	unknown protein		Potri.003G101100 [exp]	24.49	0.8433
AT5G35080			unknown protein		Potri.018G118200 [exp]	24.61	0.8531
AT1G21930			unknown protein		Potri.002G086300 [exp]	29.29	0.8277

Compare expression of checked genes

Potri.002G043600 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.