Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G22270 169 / 1e-55 Trm112p-like protein (.1) AT1G78190 159 / 8e-52 Trm112p-like protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.005G165000 [exp] 201 / 2e-68 AT1G22270 165 / 4e-54 Trm112p-like protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10032269 [exp] 182 / 1e-60 AT1G78190 186 / 3e-62 Trm112p-like protein (.1) Lus10024634 [exp] 176 / 2e-58 AT1G78190 187 / 8e-63 Trm112p-like protein (.1) Lus10017505 [exp] 167 / 1e-54 AT1G78190 175 / 6e-58 Trm112p-like protein (.1) Lus10028778 [exp] 146 / 9e-42 AT5G45140 1711 / 0.0 nuclear RNA polymerase C2 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0167 [poplar] [flax] Zn_Beta_Ribbon PF03966 [poplar] [flax] Trm112p Trm112p-like protein
Representative CDS sequence Show only first row Show all	>Potri.002G096600.1 pacid=42776943 polypeptide=Potri.002G096600.1.p locus=Potri.002G096600 ID=Potri.002G096600.1.v4.1 annot-version=v4.1 ATGAGGCTATTTACTCACAACATGCTATCCTCCAATATCAAGGGAGTTGCGAACGGCTTCCCTCTAAGAATCGAGGTAGATCAAGTGGTCGAAAAGCAAG TGGACTTCAATCCCGATTTCCTCAGAAACATGTTCCCAAAGCTCGAGTGGAAAGCCCTTGTCGATGCCGCACGAACCATGGGCTACACCGAGCTTCCTGA GGAGGCCGATTCGTCGATGCTGGAGTCTGAGGAATTTTTAAGGAAGTTGCACCACGCGCTTTTGGAGCTTCACCTCGAAGAAGGGGCTTTGGTTTGTCCT GAGACTGGGAGAAAGTTTCCGGTCAATAAAGGGATTCCTAATATGCTTCTTCACGAAGATGAGGTTTGA
AA sequence Show only first row Show all	>Potri.002G096600.1 pacid=42776943 polypeptide=Potri.002G096600.1.p locus=Potri.002G096600 ID=Potri.002G096600.1.v4.1 annot-version=v4.1 MRLFTHNMLSSNIKGVANGFPLRIEVDQVVEKQVDFNPDFLRNMFPKLEWKALVDAARTMGYTELPEEADSSMLESEEFLRKLHHALLELHLEEGALVCP ETGRKFPVNKGIPNMLLHEDEV

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G22270			Trm112p-like protein (.1)		Potri.002G096600 [exp]	0	1
AT5G06240		EMB2735	embryo defective 2735 (.1)		Potri.016G074700 [exp]	2.64	0.8702
AT3G02790	C2H2ZnF		zinc finger (C2H2 type) family...		Potri.013G086400 [exp]	3.46	0.8380
AT4G27130			Translation initiation factor ...		Potri.011G134700 [exp]	4.69	0.8574
AT5G51940		NRPE6A, NRPD6A,...	RNA polymerase Rpb6 (.1)		Potri.012G136900 [exp]	6.70	0.8551
AT1G51200			A20/AN1-like zinc finger famil...		Potri.003G205500 [exp]	7.74	0.8411
AT5G12210		AtRGTB1	RAB geranylgeranyl transferase...		Potri.013G012500 [exp]	8.24	0.7964
AT3G26410		TRM11, AtTRM11	tRNA modification 11, methyltr...		Potri.001G207000 [exp]	9.16	0.8505
					Potri.010G058600 [exp]	10.00	0.8143
AT3G05700			Drought-responsive family prot...		Potri.013G011200 [exp]	12.40	0.8296
AT1G68310		AE7	AS1/2 ENHANCER7, Protein of un...		Potri.003G098000 [exp]	12.40	0.8124

Compare expression of checked genes

Potri.002G096600 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.