Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G02380 74 / 1e-18 SAG21, ATLEA5 Arabidopsis thaliana late embryogenensis abundant like 5, senescence-associated gene 21 (.1.2) AT1G02820 67 / 5e-16 Late embryogenesis abundant 3 (LEA3) family protein (.1) AT3G53770 50 / 2e-09 late embryogenesis abundant 3 (LEA3) family protein (.1), late embryogenesis abundant 3 (LEA3) family protein (.2) AT4G15910 50 / 2e-09 ATDI21 drought-induced 21 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.014G127700 [exp] 124 / 2e-38 AT4G02380 79 / 1e-20 Arabidopsis thaliana late embryogenensis abundant like 5, senescence-associated gene 21 (.1.2) Potri.010G012100 [exp] 50 / 4e-09 AT4G15910 83 / 6e-22 drought-induced 21 (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10008170 [exp] 84 / 9e-23 AT4G02380 83 / 3e-22 Arabidopsis thaliana late embryogenensis abundant like 5, senescence-associated gene 21 (.1.2) Lus10027986 [exp] 81 / 2e-21 AT1G02820 78 / 3e-20 Late embryogenesis abundant 3 (LEA3) family protein (.1) Lus10042672 [exp] 77 / 8e-20 AT4G02380 63 / 2e-14 Arabidopsis thaliana late embryogenensis abundant like 5, senescence-associated gene 21 (.1.2) Lus10029634 [exp] 73 / 2e-18 AT4G02380 57 / 4e-12 Arabidopsis thaliana late embryogenensis abundant like 5, senescence-associated gene 21 (.1.2) Lus10027987 [exp] 71 / 1e-17 AT1G02820 67 / 5e-16 Late embryogenesis abundant 3 (LEA3) family protein (.1) Lus10008169 [exp] 70 / 2e-17 AT1G02820 66 / 6e-16 Late embryogenesis abundant 3 (LEA3) family protein (.1) Lus10006508 [exp] 49 / 4e-09 AT4G15910 73 / 2e-18 drought-induced 21 (.1) Lus10037497 [exp] 49 / 1e-08 AT4G15910 73 / 5e-18 drought-induced 21 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF03242 [poplar] [flax] LEA_3 Late embryogenesis abundant protein
Representative CDS sequence Show only first row Show all	>Potri.002G203500.1 pacid=42779863 polypeptide=Potri.002G203500.1.p locus=Potri.002G203500 ID=Potri.002G203500.1.v4.1 annot-version=v4.1 ATGGCTCGTTCTTTCTCAAACGCCAAGGTCATCTCTGGCCTGATCAGCGAGGCAATCAACGGCAGAGGATTCTCAGCTGTTGCATCCCAAGGAGCTGCTG TGTCCAAGGCAAGAAGCGGTGCTGCTGTAATGAAGAAAACAGGGGAGGAGGTTACCAAGACCACCGAGAAGATTTCCTGGGTTCCAGATCCTCGTACTGG ATTCTACAGACCAGAGAATGTTGCTCAGGAAATCGATGCGGCTGAATTACGTGCTACTCTCTTGAAGAAGCATTGA
AA sequence Show only first row Show all	>Potri.002G203500.1 pacid=42779863 polypeptide=Potri.002G203500.1.p locus=Potri.002G203500 ID=Potri.002G203500.1.v4.1 annot-version=v4.1 MARSFSNAKVISGLISEAINGRGFSAVASQGAAVSKARSGAAVMKKTGEEVTKTTEKISWVPDPRTGFYRPENVAQEIDAAELRATLLKKH

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT4G02380		SAG21, ATLEA5	Arabidopsis thaliana late embr...		Potri.002G203500 [exp]	0	1
AT5G67080		MAPKKK19	mitogen-activated protein kina...		Potri.005G139200 [exp]	1.41	0.8911
AT3G23230	AP2_ERF	ERF98	Integrase-type DNA-binding sup...		Potri.002G039200 [exp]	4.89	0.8450
AT4G17500	AP2_ERF	ATERF-1, AtERF1	ethylene responsive element bi...		Potri.003G081200 [exp]	5.74	0.9058
AT5G36930			Disease resistance protein (TI...		Potri.019G007884 [exp]	7.48	0.8781
AT2G48010		RKF3	receptor-like kinase in in flo...		Potri.014G136466 [exp]	9.89	0.8710
AT4G36990	HSF	AT-HSFB1, ATHSF...	ARABIDOPSIS THALIANA HEAT SHOC...		Potri.007G043800 [exp]	10.19	0.8244
AT1G07530	GRAS	SCL14, ATGRAS2	GRAS \(GAI, RGA, SCR\) 2, ARAB...		Potri.001G241800 [exp]	10.95	0.8663
AT4G23030			MATE efflux family protein (.1...		Potri.015G135600 [exp]	11.09	0.8080
AT2G40000		ATHSPRO2	ARABIDOPSIS ORTHOLOG OF SUGAR ...		Potri.010G191300 [exp]	11.40	0.8740
AT1G35210			unknown protein		Potri.002G100500 [exp]	13.19	0.8714

Compare expression of checked genes

Potri.002G203500 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.