Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT2G44310 63 / 2e-14 Calcium-binding EF-hand family protein (.1) AT4G38810 41 / 2e-05 Calcium-binding EF-hand family protein (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G219000 [exp] 127 / 1e-39 AT2G44310 137 / 1e-42 Calcium-binding EF-hand family protein (.1) Potri.002G218800 [exp] 127 / 1e-39 AT2G44310 137 / 1e-42 Calcium-binding EF-hand family protein (.1) Potri.002G218750 [exp] 127 / 1e-39 AT2G44310 136 / 3e-42 Calcium-binding EF-hand family protein (.1) Potri.002G218700 [exp] 127 / 1e-39 AT2G44310 137 / 3e-42 Calcium-binding EF-hand family protein (.1) Potri.002G218725 [exp] 127 / 1e-39 AT2G44310 135 / 1e-41 Calcium-binding EF-hand family protein (.1) Potri.002G218500 [exp] 127 / 1e-39 AT2G44310 140 / 7e-44 Calcium-binding EF-hand family protein (.1) Potri.002G218300 [exp] 125 / 7e-39 AT2G44310 138 / 9e-43 Calcium-binding EF-hand family protein (.1) Potri.002G218201 [exp] 125 / 8e-39 AT2G44310 136 / 4e-42 Calcium-binding EF-hand family protein (.1) Potri.014G161200 [exp] 111 / 4e-33 AT2G44310 143 / 1e-44 Calcium-binding EF-hand family protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10035578 [exp] 52 / 5e-10 AT2G44310 182 / 3e-60 Calcium-binding EF-hand family protein (.1) Lus10008649 [exp] 50 / 3e-09 AT2G44310 177 / 2e-58 Calcium-binding EF-hand family protein (.1) Lus10009192 [exp] 37 / 0.0002 AT2G44310 94 / 1e-25 Calcium-binding EF-hand family protein (.1) Lus10007567 [exp] 37 / 0.0005 AT4G38810 499 / 6e-178 Calcium-binding EF-hand family protein (.1.2)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.002G218775.1 pacid=42778386 polypeptide=Potri.002G218775.1.p locus=Potri.002G218775 ID=Potri.002G218775.1.v4.1 annot-version=v4.1 ATGAGTGTGGAGATTTTGGATGGTGCCACCATTGTCAACTTTCTGGAGGACGAGGAAGCATTCAACGCGCAAATATGTGACCGCTTCGCCCACCTTGATT CAGACCATGATGGCCGGCTTTCCTACGGGGAAATGTTGAAGGAGCTGCAGTGTTTGAGGTTATTGGAAACCCACTTCGGCCTGATTAATTCCACATCCAT TACCCTATACATGACTCATTAA
AA sequence Show only first row Show all	>Potri.002G218775.1 pacid=42778386 polypeptide=Potri.002G218775.1.p locus=Potri.002G218775 ID=Potri.002G218775.1.v4.1 annot-version=v4.1 MSVEILDGATIVNFLEDEEAFNAQICDRFAHLDSDHDGRLSYGEMLKELQCLRLLETHFGLINSTSITLYMTH

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT2G44310			Calcium-binding EF-hand family...		Potri.002G218775 [exp]	0	1
AT2G44310			Calcium-binding EF-hand family...		Potri.002G219000 [exp]	2.64	0.9819
AT2G30970		ASP1	aspartate aminotransferase 1 (...		Potri.006G107100 [exp]	3.31	0.9408
AT2G44310			Calcium-binding EF-hand family...		Potri.002G218750 [exp]	4.00	0.9766
AT3G16770	AP2_ERF	RAP2.03, ATEBP,...	RELATED TO AP2 3, ETHYLENE RES...		Potri.002G201600 [exp]	4.35	0.9152
AT2G44310			Calcium-binding EF-hand family...		Potri.002G218700 [exp]	5.74	0.9660
AT2G44310			Calcium-binding EF-hand family...		Potri.002G218300 [exp]	6.00	0.9631
AT2G44310			Calcium-binding EF-hand family...		Potri.002G218800 [exp]	7.41	0.9615
AT2G44310			Calcium-binding EF-hand family...		Potri.002G218725 [exp]	7.48	0.9511
					Potri.004G148100 [exp]	7.48	0.9503
AT2G44310			Calcium-binding EF-hand family...		Potri.002G218201 [exp]	9.79	0.9524

Compare expression of checked genes

Potri.002G218775 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.