Potri.003G010598 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.003G010565 222 / 3e-77 ND /
Potri.003G010466 218 / 1e-75 ND /
Potri.003G010433 179 / 5e-60 ND /
Potri.003G010499 177 / 1e-59 ND /
Potri.003G010532 174 / 2e-58 ND /
Potri.003G010730 129 / 3e-40 ND /
Potri.003G010664 107 / 2e-31 ND /
Potri.004G221500 67 / 5e-16 ND /
Potri.004G221450 67 / 6e-16 ND /
Flax homologues

No hit found

PFAM info
Representative CDS sequence
>Potri.003G010598.1 pacid=42785160 polypeptide=Potri.003G010598.1.p locus=Potri.003G010598 ID=Potri.003G010598.1.v4.1 annot-version=v4.1
ATGGAAATGTTCACAAAGCAACTCACCCATATTGATCTTGGGAGAGGATTGGAGCTACCACAGTACAATTCTAACCTAAAACCCCTGCAACATATTCAAG
GGACCTTAGAATTGTCCACCATAGTTGAGTCAGCTGCTGGAACCCGTTTACCGGACCCGGTGACAATTCACTGCTCAGCCATAAGAGGAAGCCTTGTATT
TAAAACAGGTTGGTATGCTATTGCTCGCGATATTGGCCTCAAAAGTGGAGACACTGTGACTTTCTATCAGGAGGTTAACGGAGGAGCACAGTTCAAATTG
AAAGTGAGAAATTTTCGTTAA
AA sequence
>Potri.003G010598.1 pacid=42785160 polypeptide=Potri.003G010598.1.p locus=Potri.003G010598 ID=Potri.003G010598.1.v4.1 annot-version=v4.1
MEMFTKQLTHIDLGRGLELPQYNSNLKPLQHIQGTLELSTIVESAAGTRLPDPVTIHCSAIRGSLVFKTGWYAIARDIGLKSGDTVTFYQEVNGGAQFKL
KVRNFR

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.003G010598 0 1
Potri.003G010565 1.00 0.9985
Potri.003G010466 8.94 0.9977
Potri.003G010532 12.12 0.9975
AT5G42650 CYP74A, AOS, DD... DELAYED DEHISCENCE 2, CYTOCHRO... Potri.004G148600 14.42 0.9971
AT5G42650 CYP74A, AOS, DD... DELAYED DEHISCENCE 2, CYTOCHRO... Potri.004G148900 16.43 0.9971
AT4G01500 B3 NGA4 NGATHA4, AP2/B3-like transcrip... Potri.004G221300 16.49 0.9959
Potri.003G010730 17.94 0.9971
Potri.006G260948 18.16 0.9971
Potri.006G261111 20.97 0.9970
Potri.003G010499 22.44 0.9968

Potri.003G010598 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.