Potri.003G073600 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT1G53750 39 / 3e-05 RPT1A regulatory particle triple-A 1A (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.006G216600 39 / 3e-05 AT1G53750 804 / 0.0 regulatory particle triple-A 1A (.1)
Potri.018G056600 39 / 3e-05 AT1G53750 803 / 0.0 regulatory particle triple-A 1A (.1)
Potri.001G161700 38 / 5e-05 AT1G53750 809 / 0.0 regulatory particle triple-A 1A (.1)
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10031815 39 / 4e-05 AT1G53750 828 / 0.0 regulatory particle triple-A 1A (.1)
Lus10031243 39 / 4e-05 AT1G53750 841 / 0.0 regulatory particle triple-A 1A (.1)
PFAM info
Representative CDS sequence
>Potri.003G073600.1 pacid=42785864 polypeptide=Potri.003G073600.1.p locus=Potri.003G073600 ID=Potri.003G073600.1.v4.1 annot-version=v4.1
ATGAATTGTGAAAGGGAGATCCGGTTTGATCTTTTGGCTCGGCTTTCTCAGAATTCAACAGCAGGGGCTCATTCAGGTGACCGGGCGGTGGAAACTTGGT
TAAAATCTGAGGTTGCAGCCATGGTGCTATCATCTGTGTGGTGTGTGTGTGCGCGTGAATAG
AA sequence
>Potri.003G073600.1 pacid=42785864 polypeptide=Potri.003G073600.1.p locus=Potri.003G073600 ID=Potri.003G073600.1.v4.1 annot-version=v4.1
MNCEREIRFDLLARLSQNSTAGAHSGDRAVETWLKSEVAAMVLSSVWCVCARE

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT1G53750 RPT1A regulatory particle triple-A 1... Potri.003G073600 0 1
AT1G55200 Protein kinase protein with ad... Potri.014G146500 14.21 0.8718
AT5G03990 unknown protein Potri.006G045900 21.77 0.8684
AT1G48780 unknown protein Potri.012G055300 38.65 0.8498
Potri.018G120450 78.14 0.8006
AT5G63830 HIT-type Zinc finger family pr... Potri.003G145100 93.59 0.8303
AT1G16130 WAKL2 wall associated kinase-like 2 ... Potri.009G154300 95.76 0.8309
AT3G02860 C2H2ZnF zinc ion binding (.1.2) Potri.017G135500 96.27 0.8326
AT3G60220 ATL4 TOXICOS EN LEVADURA 4 (.1) Potri.002G140600 116.74 0.8002
AT1G56400 F-box family protein (.1.2) Potri.011G136200 124.09 0.8276
Potri.005G176466 127.57 0.8147

Potri.003G073600 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.