Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G30020 49 / 6e-08 PA-domain containing subtilase family protein (.1) AT2G19170 48 / 1e-07 SLP3 subtilisin-like serine protease 3 (.1) AT1G62340 44 / 3e-06 ALE1 ABNORMAL LEAF-SHAPE 1, ABNORMAL LEAF-SHAPE, PA-domain containing subtilase family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G092700 [exp] 171 / 4e-57 AT2G19170 51 / 8e-09 subtilisin-like serine protease 3 (.1) Potri.018G143400 [exp] 49 / 4e-08 AT4G30020 1338 / 0.0 PA-domain containing subtilase family protein (.1) Potri.006G076200 [exp] 43 / 6e-06 AT2G19170 1342 / 0.0 subtilisin-like serine protease 3 (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10001901 [exp] 141 / 4e-45 ND 42 / 2e-05 Lus10015559 [exp] 46 / 7e-07 AT1G62340 903 / 0.0 ABNORMAL LEAF-SHAPE 1, ABNORMAL LEAF-SHAPE, PA-domain containing subtilase family protein (.1) Lus10001310 [exp] 42 / 2e-05 AT4G30020 1258 / 0.0 PA-domain containing subtilase family protein (.1) Lus10006973 [exp] 42 / 3e-05 AT4G30020 1334 / 0.0 PA-domain containing subtilase family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0570 [poplar] [flax] PPP-I PF05922 [poplar] [flax] Inhibitor_I9 Peptidase inhibitor I9
Representative CDS sequence Show only first row Show all	>Potri.003G138800.1 pacid=42786869 polypeptide=Potri.003G138800.1.p locus=Potri.003G138800 ID=Potri.003G138800.1.v4.1 annot-version=v4.1 ATGGGGAGTAAAGAAAGGGAGAGATATTTTGTTTTCATGGACTATGATCCTGAATATGAGCGCATTCGAAATGATCGGACAAAGAGAGGAGCATATGAGC TCGACATGTATCTGAGCAGGAAGCATGATGAGTTATTGGCAAACACCCTTGCGCATGGCAGCTACAAGAAGACAATATCTTTGATCATTGTTGATGGTTT TGCAGTAGAAATCACTGAAGACCAGGCAAATGCGCTTAGATCTACTAATGGGGTGAGAGTTGTGGAGAAGAATCAAGAATTTCCGAATTAA
AA sequence Show only first row Show all	>Potri.003G138800.1 pacid=42786869 polypeptide=Potri.003G138800.1.p locus=Potri.003G138800 ID=Potri.003G138800.1.v4.1 annot-version=v4.1 MGSKERERYFVFMDYDPEYERIRNDRTKRGAYELDMYLSRKHDELLANTLAHGSYKKTISLIIVDGFAVEITEDQANALRSTNGVRVVEKNQEFPN

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT2G19170		SLP3	subtilisin-like serine proteas...		Potri.003G138800 [exp]	0	1
AT4G14723		EPFL4, CLL2	epidermal patterning factor li...		Potri.008G157300 [exp]	4.58	0.9351
AT1G69940		ATPPME1	Pectin lyase-like superfamily ...		Potri.015G110700 [exp]	7.74	0.9247
AT2G23060			Acyl-CoA N-acyltransferases (N...		Potri.010G144700 [exp]	9.32	0.9239
AT3G13960	GRF	ATGRF5	growth-regulating factor 5 (.1...		Potri.001G169100 [exp]	11.48	0.9069
AT5G63090	AS2	LOBB, LOB	Lateral organ boundaries (LOB)...		Potri.015G082200 [exp]	11.61	0.8772
AT3G30300			O-fucosyltransferase family pr...		Potri.004G113200 [exp]	12.08	0.8203
AT4G21750	HD	ATML1	MERISTEM LAYER 1, Homeobox-leu...		Potri.011G025000 [exp]	12.32	0.9211	Pt-ATML1.1
AT2G44480		BGLU17	beta glucosidase 17 (.1.2)		Potri.001G227400 [exp]	14.00	0.9188
AT2G30370		EPFL6, CHAL	EPF1-like 6, CHALLAH, allergen...		Potri.013G155500 [exp]	14.69	0.9161
AT5G04530		KCS19	3-ketoacyl-CoA synthase 19 (.1...		Potri.010G212600 [exp]	14.89	0.9201

Compare expression of checked genes

Potri.003G138800 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.