Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G47890 152 / 1e-49 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G071900 [exp] 192 / 2e-65 AT5G47890 145 / 8e-47 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1) Potri.013G126200 [exp] 39 / 7e-05 AT3G59650 202 / 8e-69 mitochondrial ribosomal protein L51/S25/CI-B8 family protein (.1.2)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10011053 [exp] 173 / 7e-58 AT5G47890 155 / 4e-51 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1) Lus10003023 [exp] 171 / 6e-57 AT5G47890 155 / 4e-51 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1) Lus10040122 [exp] 157 / 1e-51 AT5G47890 150 / 8e-49 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1) Lus10030922 [exp] 156 / 3e-51 AT5G47890 149 / 2e-48 NADH-ubiquinone oxidoreductase B8 subunit, putative (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0172 [poplar] [flax] Thioredoxin PF05047 [poplar] [flax] L51_S25_CI-B8 Mitochondrial ribosomal protein L51 / S25 / CI-B8 domain
Representative CDS sequence Show only first row Show all	>Potri.003G159100.1 pacid=42785596 polypeptide=Potri.003G159100.1.p locus=Potri.003G159100 ID=Potri.003G159100.1.v4.1 annot-version=v4.1 ATGGCATGGAGAGGACAACTTTCTAAGAACCTGAAAGAGCTTCGAATTCTTCTATGCCAATCTTCCCCTTCAAGTTCGACTACTAGAACGTTTATAGAGA GGAGTTATAAGGATCTCAAAACCCTTAACCCAAAACTTCCCATATTGATCCGTGAATGCAATGGAATAGAACCTCAGTTATGGGCTAGATATGATTTTGG TGTTGAGAGGGGCGTTCGGTTGGAAGGTTTAAGTGAGGCCCAGATCTCGAAGGCCCTAGAAGAGCTTGGGAAAGTGGGTGCATCGCTTAAGGTTTGA
AA sequence Show only first row Show all	>Potri.003G159100.1 pacid=42785596 polypeptide=Potri.003G159100.1.p locus=Potri.003G159100 ID=Potri.003G159100.1.v4.1 annot-version=v4.1 MAWRGQLSKNLKELRILLCQSSPSSSTTRTFIERSYKDLKTLNPKLPILIRECNGIEPQLWARYDFGVERGVRLEGLSEAQISKALEELGKVGASLKV

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G47890			NADH-ubiquinone oxidoreductase...		Potri.003G159100 [exp]	0	1
AT1G80500			SNARE-like superfamily protein...		Potri.003G183400 [exp]	1.73	0.8698
AT5G27200		ACP5	acyl carrier protein 5 (.1)		Potri.005G044800 [exp]	2.44	0.8651	Pt-ACP1.1
AT3G05100			S-adenosyl-L-methionine-depend...		Potri.013G034000 [exp]	4.00	0.8505
AT4G37608			unknown protein		Potri.009G004400 [exp]	8.06	0.8249
AT4G30010			unknown protein		Potri.006G075600 [exp]	8.30	0.8591
AT4G29735			unknown protein		Potri.006G146800 [exp]	8.48	0.8140
AT4G00570		NAD-ME2	NAD-dependent malic enzyme 2 (...		Potri.014G079900 [exp]	10.72	0.6929
AT1G19580		GAMMACA1 ,GAMMA...	gamma carbonic anhydrase 1 (.1...		Potri.005G120800 [exp]	10.95	0.7911
AT4G00170			Plant VAMP (vesicle-associated...		Potri.002G144800 [exp]	11.48	0.7755
AT1G61150			LisH and RanBPM domains contai...		Potri.011G046200 [exp]	11.74	0.8217

Compare expression of checked genes

Potri.003G159100 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.