Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G63700 57 / 6e-11 EMB71, MAPKKK4, YDA YODA, MAP KINASE KINASE KINASE 4, EMBRYO DEFECTIVE 71, Protein kinase superfamily protein (.1) AT3G50310 55 / 3e-10 MKKK20, MAPKKK20 MAPKK kinase 20, mitogen-activated protein kinase kinase kinase 20 (.1) AT5G66850 55 / 4e-10 MAPKKK5 mitogen-activated protein kinase kinase kinase 5 (.1) AT5G67080 52 / 2e-09 MAPKKK19 mitogen-activated protein kinase kinase kinase 19 (.1) AT4G36950 50 / 3e-08 MAPKKK21 mitogen-activated protein kinase kinase kinase 21 (.1) AT1G53570 49 / 7e-08 MAPKKK3, MAP3KA MAP KINASE KINASE KINASE 3, mitogen-activated protein kinase kinase kinase 3 (.1.2.3.4.5) AT5G55090 48 / 9e-08 MAPKKK15 mitogen-activated protein kinase kinase kinase 15 (.1) AT1G54960 45 / 8e-07 MAPKKK2, ANP2 MITOGEN-ACTIVATED PROTEIN KINASE KINASE KINASES 2, NPK1-related protein kinase 2 (.1) AT1G09000 45 / 1e-06 MAPKKK1, ANP1 MAP KINASE KINASE KINASE 1, NPK1-related protein kinase 1 (.1) AT4G26890 45 / 2e-06 MAPKKK16 mitogen-activated protein kinase kinase kinase 16 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.007G039800 [exp] 59 / 1e-11 AT5G66850 511 / 3e-173 mitogen-activated protein kinase kinase kinase 5 (.1) Potri.005G135100 [exp] 56 / 1e-10 AT5G66850 589 / 0.0 mitogen-activated protein kinase kinase kinase 5 (.1) Potri.001G102900 [exp] 56 / 3e-10 AT1G63700 868 / 0.0 YODA, MAP KINASE KINASE KINASE 4, EMBRYO DEFECTIVE 71, Protein kinase superfamily protein (.1) Potri.015G146700 [exp] 54 / 6e-10 AT1G63700 826 / 0.0 YODA, MAP KINASE KINASE KINASE 4, EMBRYO DEFECTIVE 71, Protein kinase superfamily protein (.1) Potri.012G143900 [exp] 53 / 2e-09 AT1G63700 766 / 0.0 YODA, MAP KINASE KINASE KINASE 4, EMBRYO DEFECTIVE 71, Protein kinase superfamily protein (.1) Potri.003G129000 [exp] 52 / 4e-09 AT1G63700 850 / 0.0 YODA, MAP KINASE KINASE KINASE 4, EMBRYO DEFECTIVE 71, Protein kinase superfamily protein (.1) Potri.002G129100 [exp] 52 / 4e-09 AT5G66850 441 / 5e-145 mitogen-activated protein kinase kinase kinase 5 (.1) Potri.005G139300 [exp] 51 / 1e-08 AT5G67080 329 / 6e-112 mitogen-activated protein kinase kinase kinase 19 (.1) Potri.007G044800 [exp] 50 / 2e-08 AT5G67080 350 / 6e-120 mitogen-activated protein kinase kinase kinase 19 (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10039250 [exp] 59 / 2e-11 AT1G63700 818 / 0.0 YODA, MAP KINASE KINASE KINASE 4, EMBRYO DEFECTIVE 71, Protein kinase superfamily protein (.1) Lus10027496 [exp] 57 / 1e-10 AT1G63700 855 / 0.0 YODA, MAP KINASE KINASE KINASE 4, EMBRYO DEFECTIVE 71, Protein kinase superfamily protein (.1) Lus10024645 [exp] 56 / 3e-10 AT1G63700 905 / 0.0 YODA, MAP KINASE KINASE KINASE 4, EMBRYO DEFECTIVE 71, Protein kinase superfamily protein (.1) Lus10032279 [exp] 55 / 4e-10 AT1G63700 904 / 0.0 YODA, MAP KINASE KINASE KINASE 4, EMBRYO DEFECTIVE 71, Protein kinase superfamily protein (.1) Lus10021766 [exp] 55 / 4e-10 AT5G66850 452 / 7e-148 mitogen-activated protein kinase kinase kinase 5 (.1) Lus10038858 [exp] 55 / 4e-10 AT1G63700 668 / 0.0 YODA, MAP KINASE KINASE KINASE 4, EMBRYO DEFECTIVE 71, Protein kinase superfamily protein (.1) Lus10012668 [exp] 52 / 5e-09 AT3G50310 347 / 5e-119 MAPKK kinase 20, mitogen-activated protein kinase kinase kinase 20 (.1) Lus10014976 [exp] 52 / 6e-09 AT1G63700 704 / 0.0 YODA, MAP KINASE KINASE KINASE 4, EMBRYO DEFECTIVE 71, Protein kinase superfamily protein (.1) Lus10022461 [exp] 49 / 4e-08 AT5G66810 756 / 0.0 unknown protein Lus10030042 [exp] 49 / 6e-08 AT2G32510 324 / 2e-108 mitogen-activated protein kinase kinase kinase 17 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0016 [poplar] [flax] PKinase PF00069 [poplar] [flax] Pkinase Protein kinase domain
Representative CDS sequence Show only first row Show all	>Potri.003G184300.2 pacid=42786037 polypeptide=Potri.003G184300.2.p locus=Potri.003G184300 ID=Potri.003G184300.2.v4.1 annot-version=v4.1 ATGATTGGTTCTGCACACGAATCGCCAGCTATTCCTAGTAACATATCAGAGGAAGGTAAGGATTTTCTCCGGTGCTGCTTTGCAAGGAATCCTGCACGGA GATCAACAGCAAGTGAGCTCCTGAATAACAAGTATGTGATGGCATTTAAGGAAGAAGGAGAGAGAAAGGGTAGTGAAAGAGAGGAGGTCTTGAATCTTGA AAGGTTCAGTTTACCACTGTCTTCAACTTATGAGGCGAGGACATCTTTGTATCTCTGGAGCATTCTTCATCCGGTTCCCTTTTAG
AA sequence Show only first row Show all	>Potri.003G184300.2 pacid=42786037 polypeptide=Potri.003G184300.2.p locus=Potri.003G184300 ID=Potri.003G184300.2.v4.1 annot-version=v4.1 MIGSAHESPAIPSNISEEGKDFLRCCFARNPARRSTASELLNNKYVMAFKEEGERKGSEREEVLNLERFSLPLSSTYEARTSLYLWSILHPVPF

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G63700		EMB71, MAPKKK4,...	YODA, MAP KINASE KINASE KINASE...		Potri.003G184300 [exp]	0	1
AT5G43700	AUX_IAA	IAA4, ATAUX2-11	indole-3-acetic acid inducible...		Potri.008G161100 [exp]	30.98	0.6353
AT3G55240			Plant protein 1589 of unknown ...		Potri.010G211500 [exp]	163.69	0.5988
AT5G13460		IQD11	IQ-domain 11 (.1)		Potri.001G021000 [exp]	233.34	0.6069

Compare expression of checked genes

Potri.003G184300 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.