Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G62040 216 / 3e-74 ATG8C autophagy 8c, Ubiquitin-like superfamily protein (.1.2) AT2G05630 209 / 2e-71 ATG8D Ubiquitin-like superfamily protein (.1.2) AT4G21980 205 / 6e-70 ATG8A, APG8A AUTOPHAGY-RELATED 8A, AUTOPHAGY 8A, Ubiquitin-like superfamily protein (.1.2) AT4G04620 202 / 9e-69 ATG8B autophagy 8b, Ubiquitin-like superfamily protein (.1.2) AT4G16520 194 / 2e-65 ATG8F autophagy 8f, Ubiquitin-like superfamily protein (.1.2) AT3G60640 187 / 9e-63 ATG8G AUTOPHAGY 8G, Ubiquitin-like superfamily protein (.1) AT2G45170 186 / 2e-62 ATATG8E AUTOPHAGY 8E (.1.2) AT3G15580 143 / 2e-45 APG8H, ATG8I AUTOPHAGY 8I, AUTOPHAGY 8H, Ubiquitin-like superfamily protein (.1) AT3G06420 137 / 6e-43 ATG8H autophagy 8h, Ubiquitin-like superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.011G004300 [exp] 224 / 4e-77 AT4G21980 219 / 1e-74 AUTOPHAGY-RELATED 8A, AUTOPHAGY 8A, Ubiquitin-like superfamily protein (.1.2) Potri.014G153800 [exp] 218 / 4e-75 AT2G05630 202 / 6e-69 Ubiquitin-like superfamily protein (.1.2) Potri.002G228800 [exp] 217 / 1e-74 AT2G05630 224 / 1e-77 Ubiquitin-like superfamily protein (.1.2) Potri.002G144600 [exp] 201 / 2e-68 AT3G60640 192 / 8e-65 AUTOPHAGY 8G, Ubiquitin-like superfamily protein (.1) Potri.001G122700 [exp] 196 / 3e-66 AT4G16520 191 / 2e-64 autophagy 8f, Ubiquitin-like superfamily protein (.1.2) Potri.003G110901 [exp] 196 / 3e-66 AT4G16520 197 / 1e-66 autophagy 8f, Ubiquitin-like superfamily protein (.1.2) Potri.008G136040 [exp] 196 / 3e-66 AT4G16520 197 / 1e-66 autophagy 8f, Ubiquitin-like superfamily protein (.1.2) Potri.014G060300 [exp] 187 / 8e-63 AT4G16520 214 / 1e-73 autophagy 8f, Ubiquitin-like superfamily protein (.1.2) Potri.008G099400 [exp] 147 / 6e-47 AT3G15580 187 / 7e-63 AUTOPHAGY 8I, AUTOPHAGY 8H, Ubiquitin-like superfamily protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10015563 [exp] 218 / 4e-75 AT1G62040 230 / 1e-79 autophagy 8c, Ubiquitin-like superfamily protein (.1.2) Lus10027186 [exp] 217 / 2e-74 AT2G05630 222 / 1e-76 Ubiquitin-like superfamily protein (.1.2) Lus10039656 [exp] 198 / 5e-66 AT2G05630 203 / 6e-68 Ubiquitin-like superfamily protein (.1.2) Lus10008507 [exp] 192 / 7e-65 AT4G16520 216 / 3e-74 autophagy 8f, Ubiquitin-like superfamily protein (.1.2) Lus10028933 [exp] 192 / 1e-64 AT4G16520 215 / 6e-74 autophagy 8f, Ubiquitin-like superfamily protein (.1.2) Lus10000733 [exp] 191 / 2e-64 AT4G16520 217 / 1e-74 autophagy 8f, Ubiquitin-like superfamily protein (.1.2) Lus10004352 [exp] 184 / 2e-61 AT2G45170 203 / 1e-68 AUTOPHAGY 8E (.1.2) Lus10038046 [exp] 144 / 1e-45 AT3G15580 199 / 1e-67 AUTOPHAGY 8I, AUTOPHAGY 8H, Ubiquitin-like superfamily protein (.1) Lus10009987 [exp] 136 / 3e-38 AT3G62240 625 / 0.0 RING/U-box superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0072 [poplar] [flax] Ubiquitin PF04110 [poplar] [flax] APG12 Ubiquitin-like autophagy protein Apg12
Representative CDS sequence Show only first row Show all	>Potri.004G013700.2 pacid=42794144 polypeptide=Potri.004G013700.2.p locus=Potri.004G013700 ID=Potri.004G013700.2.v4.1 annot-version=v4.1 ATGGATAGAAGTTCATTCAAGCTTGATCATACTTTGGAGAGGAGGCAAGCAGAAGCTTCTCGCATCAGAGAGAAATATCCTGATAGAGTACCTGTGATTG TGGAAAGGGCTGAAAGGAGTGATATCCCTGACATTGATAAGAAGAAATATCTCGTGCCAGCTGATTTGACTGTGGGTCAGTTTGTTTATGTTGTCCGGAA AAGGATCAAGCTCGGTCCTGAGAAGGCTATATTTGTCTTTGTAAAAAACACTCTGCCTTCTACCGCTTCATTGATGTCTGCAATCTATGAGGAAAACAAG GATGAAGATGGTTTTCTTTACATGACATACAGTGGGGAGAATACCTTTGGATTGCACTAG
AA sequence Show only first row Show all	>Potri.004G013700.2 pacid=42794144 polypeptide=Potri.004G013700.2.p locus=Potri.004G013700 ID=Potri.004G013700.2.v4.1 annot-version=v4.1 MDRSSFKLDHTLERRQAEASRIREKYPDRVPVIVERAERSDIPDIDKKKYLVPADLTVGQFVYVVRKRIKLGPEKAIFVFVKNTLPSTASLMSAIYEENK DEDGFLYMTYSGENTFGLH

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G62040		ATG8C	autophagy 8c, Ubiquitin-like s...		Potri.004G013700 [exp]	0	1
AT4G33140			Haloacid dehalogenase-like hyd...		Potri.006G216500 [exp]	1.41	0.9420
AT1G10200	LIM	WLIM1, SF3	WLIM1, GATA type zinc finger t...		Potri.009G087200 [exp]	2.00	0.9396
AT3G27890		NQR	NADPH:quinone oxidoreductase (...		Potri.001G028000 [exp]	3.00	0.9209	Pt-NQR.2
AT4G09510		A/N-InvI, CINV2	alkaline/neutral invertase I, ...		Potri.013G110800 [exp]	3.00	0.8865	INV1.1
AT1G48320			Thioesterase superfamily prote...		Potri.010G003600 [exp]	3.74	0.8884
AT1G63220			Calcium-dependent lipid-bindin...		Potri.002G155600 [exp]	7.14	0.7998
AT5G27000		KATD, ATK4	KINESIN-LIKE PROTEIN IN ARABID...		Potri.013G011500 [exp]	8.71	0.8951
AT5G13500			unknown protein		Potri.001G028100 [exp]	10.67	0.8912
AT3G13275			unknown protein		Potri.011G166250 [exp]	10.72	0.8932
AT4G19045			Mob1/phocein family protein (....		Potri.001G132700 [exp]	11.48	0.8782

Compare expression of checked genes

Potri.004G013700 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.