Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G18020 122 / 6e-38 SAUR-like auxin-responsive protein family (.1) AT5G18050 121 / 1e-37 SAUR-like auxin-responsive protein family (.1) AT5G18060 120 / 3e-37 SAUR-like auxin-responsive protein family (.1) AT5G18030 120 / 4e-37 SAUR-like auxin-responsive protein family (.1) AT5G18080 119 / 8e-37 SAUR24 small auxin up RNA 24, SAUR-like auxin-responsive protein family (.1) AT5G18010 119 / 1e-36 SAUR19, SAUR24 small auxin up RNA 19, SAUR-like auxin-responsive protein family (.1) AT2G21200 118 / 2e-36 SAUR-like auxin-responsive protein family (.1) AT4G38840 117 / 1e-35 SAUR-like auxin-responsive protein family (.1) AT4G38825 113 / 2e-34 SAUR-like auxin-responsive protein family (.1) AT3G03820 112 / 1e-33 SAUR-like auxin-responsive protein family (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G165200 [exp] 130 / 3e-41 AT5G18020 122 / 6e-38 SAUR-like auxin-responsive protein family (.1) Potri.004G164800 [exp] 128 / 3e-40 AT4G38840 120 / 3e-37 SAUR-like auxin-responsive protein family (.1) Potri.009G126300 [exp] 127 / 6e-40 AT5G18060 123 / 2e-38 SAUR-like auxin-responsive protein family (.1) Potri.009G126500 [exp] 127 / 8e-40 AT5G18020 124 / 1e-38 SAUR-like auxin-responsive protein family (.1) Potri.009G126700 [exp] 127 / 1e-39 AT4G38840 126 / 3e-39 SAUR-like auxin-responsive protein family (.1) Potri.004G165500 [exp] 126 / 3e-39 AT4G34770 115 / 7e-35 SAUR-like auxin-responsive protein family (.1) Potri.004G165300 [exp] 123 / 3e-38 AT4G38840 130 / 6e-41 SAUR-like auxin-responsive protein family (.1) Potri.009G126900 [exp] 123 / 4e-38 AT4G38840 131 / 1e-41 SAUR-like auxin-responsive protein family (.1) Potri.004G165600 [exp] 122 / 6e-38 AT4G34770 118 / 4e-36 SAUR-like auxin-responsive protein family (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10027317 [exp] 122 / 1e-37 AT5G18030 119 / 1e-36 SAUR-like auxin-responsive protein family (.1) Lus10039020 [exp] 120 / 5e-37 AT5G18020 118 / 2e-36 SAUR-like auxin-responsive protein family (.1) Lus10009628 [exp] 115 / 8e-35 AT4G38840 123 / 3e-38 SAUR-like auxin-responsive protein family (.1) Lus10009623 [exp] 115 / 8e-35 AT4G38840 123 / 3e-38 SAUR-like auxin-responsive protein family (.1) Lus10042376 [exp] 114 / 2e-34 AT4G34770 136 / 3e-43 SAUR-like auxin-responsive protein family (.1) Lus10032173 [exp] 113 / 6e-34 AT4G38840 119 / 3e-36 SAUR-like auxin-responsive protein family (.1) Lus10029198 [exp] 112 / 6e-34 AT4G38840 119 / 2e-36 SAUR-like auxin-responsive protein family (.1) Lus10009001 [exp] 112 / 9e-34 AT4G38840 122 / 9e-38 SAUR-like auxin-responsive protein family (.1) Lus10007561 [exp] 111 / 4e-33 AT4G34810 125 / 1e-38 SAUR-like auxin-responsive protein family (.1) Lus10008995 [exp] 110 / 4e-33 AT4G38840 119 / 2e-36 SAUR-like auxin-responsive protein family (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF02519 [poplar] [flax] Auxin_inducible Auxin responsive protein
Representative CDS sequence Show only first row Show all	>Potri.004G164700.1 pacid=42795665 polypeptide=Potri.004G164700.1.p locus=Potri.004G164700 ID=Potri.004G164700.1.v4.1 annot-version=v4.1 ATGGCCATCCTTCTTAAGGGCATCATGAATGCTAAGCAAATTCTCCGTCGATCAAATTTGCTTGCTAACCAAGCAACCGAAGTTCCTAAAGGCTACTTTG CGGTCTATGTTGGAGAGAGCCAAAAGAAAAGATTCACAGTTCCAATTTCATTCTTGAATCAACCTTCATTCCAAGAATTGCTAAGAAAAGCCGAAGAAGA ATTCGGATATAGTCATCCGATGGGCGGTCTTACACTTCCTTGCCGAGAAGATACCTTTATTGACATCATTTCAGGCTTGAATTTATCATAA
AA sequence Show only first row Show all	>Potri.004G164700.1 pacid=42795665 polypeptide=Potri.004G164700.1.p locus=Potri.004G164700 ID=Potri.004G164700.1.v4.1 annot-version=v4.1 MAILLKGIMNAKQILRRSNLLANQATEVPKGYFAVYVGESQKKRFTVPISFLNQPSFQELLRKAEEEFGYSHPMGGLTLPCREDTFIDIISGLNLS

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G18020			SAUR-like auxin-responsive pro...		Potri.004G164700 [exp]	0	1
AT5G45910			GDSL-like Lipase/Acylhydrolase...		Potri.004G054400 [exp]	1.00	0.9997
AT5G04660		CYP77A4	"cytochrome P450, family 77, s...		Potri.008G025500 [exp]	2.00	0.9995
AT5G33370			GDSL-like Lipase/Acylhydrolase...		Potri.019G024800 [exp]	3.00	0.9991
AT4G23430		AtTic32-IVa	translocon at the inner envelo...		Potri.012G143600 [exp]	5.65	0.9981
AT1G07080			Thioredoxin superfamily protei...		Potri.016G122000 [exp]	6.00	0.9959
AT2G38110		ATGPAT6, GPAT6	glycerol-3-phosphate acyltrans...		Potri.016G113100 [exp]	6.32	0.9967
AT1G19190			alpha/beta-Hydrolases superfam...		Potri.009G104600 [exp]	7.93	0.9969
AT5G10480		PEP, PAS2	PEPINO, PASTICCINO 2, Protein-...		Potri.007G010900 [exp]	9.38	0.9743
AT5G02890			HXXXD-type acyl-transferase fa...		Potri.003G082100 [exp]	9.94	0.9965
AT1G15360	AP2_ERF	WIN1, SHN1	WAX INDUCER 1, SHINE 1, Integr...		Potri.006G069400 [exp]	10.09	0.9939

Compare expression of checked genes

Potri.004G164700 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.