Potri.004G189300 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT4G25315 139 / 6e-44 Expressed protein (.1.2)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10014065 154 / 8e-50 AT4G25315 131 / 4e-41 Expressed protein (.1.2)
Lus10019851 152 / 3e-49 AT4G25315 132 / 2e-41 Expressed protein (.1.2)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
PF11326 DUF3128 Protein of unknown function (DUF3128)
Representative CDS sequence
>Potri.004G189300.2 pacid=42795175 polypeptide=Potri.004G189300.2.p locus=Potri.004G189300 ID=Potri.004G189300.2.v4.1 annot-version=v4.1
ATGGCAACGGATCCAGAGCGGGAAGCAGCCTCTTCCTTGTCTTCAACAGCCAAACGGCGCTTATCTTGCACTACCTGCTTCGACGCTCTCTGGTTCTGCT
ACTCTCCAGTGCATCAAATGCAGCAATATTACAGGCTTGGACTTTTTGATAACTGTTCTCAGAAATGGAGTGATTTGGTCGACTGTTTGACTCTCAAGAC
TAAAAGATCTTCTCAAGTCCAGGAAATTCTAGAGGCTCGTGAGAAAGCCAAGCCCCACCTTTGGAAGCTGCGGACACCAGAAGAAGCATCAGTGCACTGG
AGACAGCTGTTTGGACACTTGGATGATGAAGTGGAATGA
AA sequence
>Potri.004G189300.2 pacid=42795175 polypeptide=Potri.004G189300.2.p locus=Potri.004G189300 ID=Potri.004G189300.2.v4.1 annot-version=v4.1
MATDPEREAASSLSSTAKRRLSCTTCFDALWFCYSPVHQMQQYYRLGLFDNCSQKWSDLVDCLTLKTKRSSQVQEILEAREKAKPHLWKLRTPEEASVHW
RQLFGHLDDEVE

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT4G25315 Expressed protein (.1.2) Potri.004G189300 0 1
AT5G35530 Ribosomal protein S3 family pr... Potri.012G076800 1.00 0.8623
AT4G26400 RING/U-box superfamily protein... Potri.017G038300 1.41 0.8605
AT5G14105 unknown protein Potri.017G066388 1.73 0.8502
AT4G17180 O-Glycosyl hydrolases family 1... Potri.006G002100 2.00 0.8476
AT2G39500 unknown protein Potri.008G051100 3.00 0.7984
AT2G06010 ORG4 OBP3-responsive gene 4 (.1) Potri.018G065800 3.31 0.7956 ORG4.2
AT3G06040 Ribosomal protein L12/ ATP-dep... Potri.015G077200 5.91 0.8215
AT4G35490 MRPL11 mitochondrial ribosomal protei... Potri.007G058600 6.00 0.8407
AT2G15000 unknown protein Potri.009G093400 7.41 0.8443
AT4G14110 FUS7, EMB143, C... FUSCA 7, EMBRYO DEFECTIVE 143,... Potri.001G207900 9.16 0.7736 EMB143.2

Potri.004G189300 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.