Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G36930 119 / 4e-31 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) AT1G27170 119 / 5e-31 transmembrane receptors;ATP binding (.1.2) AT5G41750 116 / 2e-30 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) AT1G72890 112 / 4e-29 Disease resistance protein (TIR-NBS class) (.1), Disease resistance protein (TIR-NBS class) (.2) AT4G11170 111 / 1e-28 Disease resistance protein (TIR-NBS-LRR class) family (.1) AT5G48780 111 / 2e-28 disease resistance protein (TIR-NBS class) (.1), disease resistance protein (TIR-NBS class) (.2) AT1G72920 105 / 6e-28 Toll-Interleukin-Resistance (TIR) domain family protein (.1) AT1G17615 107 / 7e-28 Disease resistance protein (TIR-NBS class) (.1) AT5G41540 108 / 2e-27 Disease resistance protein (TIR-NBS-LRR class) family (.1) AT5G17970 108 / 2e-27 Disease resistance protein (TIR-NBS-LRR class) family (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.005G004000 [exp] 196 / 1e-64 AT1G72930 107 / 6e-30 toll/interleukin-1 receptor-like (.1.2) Potri.005G004366 [exp] 185 / 4e-60 AT1G72930 114 / 1e-32 toll/interleukin-1 receptor-like (.1.2) Potri.004G230000 [exp] 188 / 6e-60 AT5G36930 169 / 4e-47 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.005G004233 [exp] 183 / 3e-58 AT1G27170 153 / 8e-42 transmembrane receptors;ATP binding (.1.2) Potri.005G004500 [exp] 180 / 3e-57 AT5G36930 152 / 3e-42 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.006G269950 [exp] 178 / 1e-56 AT5G36930 147 / 3e-40 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.007G099700 [exp] 185 / 4e-54 AT5G36930 562 / 0.0 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.011G008228 [exp] 181 / 4e-53 AT5G36930 468 / 3e-148 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.005G003900 [exp] 168 / 1e-52 AT5G36930 146 / 8e-40 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10011741 [exp] 150 / 5e-42 AT5G36930 540 / 4e-172 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Lus10005171 [exp] 144 / 5e-40 AT1G27170 576 / 0.0 transmembrane receptors;ATP binding (.1.2) Lus10014582 [exp] 137 / 1e-39 AT1G27170 186 / 9e-56 transmembrane receptors;ATP binding (.1.2) Lus10015453 [exp] 138 / 9e-39 AT1G27170 282 / 5e-84 transmembrane receptors;ATP binding (.1.2) Lus10032101 [exp] 135 / 1e-37 AT1G27170 270 / 6e-80 transmembrane receptors;ATP binding (.1.2) Lus10018972 [exp] 136 / 3e-37 AT5G36930 192 / 3e-51 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Lus10011104 [exp] 125 / 3e-33 AT5G17680 574 / 0.0 disease resistance protein (TIR-NBS-LRR class), putative (.1) Lus10042752 [exp] 115 / 6e-33 AT4G16990 145 / 5e-41 RESISTANCE TO LEPTOSPHAERIA MACULANS 3, disease resistance protein (TIR-NBS class), putative Lus10001040 [exp] 116 / 3e-32 AT5G36930 167 / 2e-47 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Lus10013729 [exp] 120 / 1e-31 AT5G36930 310 / 2e-92 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0173 [poplar] [flax] STIR PF13676 [poplar] [flax] TIR_2 TIR domain
Representative CDS sequence Show only first row Show all	>Potri.005G004100.3 pacid=42802990 polypeptide=Potri.005G004100.3.p locus=Potri.005G004100 ID=Potri.005G004100.3.v4.1 annot-version=v4.1 ATGGGTTTCTTCTCATTCATCCGTCGCTTGATGCTTATTCTCTTTGGCACGGCTAATGATCTTGTGTTCTTGAGCTTTAGCAATGAAGATACAGGAAAGA ATTTTAGTGATCATCTCAACTCAGCTCTCACCATTGCAGGATTTCGCACGTTTAAAAACGATGATGGCGTTCGAAGAGGAGAAAATACCGGCTCAGAAAC CAGAAAAGCAATACAGGAATCGAAGATATCTGTCATTGTGTTTTCCAAGGACTATGCTTCTTCAACACGGTGCCTCGACGAGCTCGTCATGATCATGGAT GCCAGGAGAGCTACTGGGCACATTGTGCTGCCCATATTTTACCATTTGGATCCATCTGAAGTCAGGAGCCAGGAAGGGAGATGTTTCGAAGCGTTTTCTA CACACGAGAAAAGCTTCCAGGGTGAGAAGGGGAGGGTGGAAGAATGGAGGGCAGCTCTTAGAGAAGCTGCAGATGTGGCAGGGATGGTTCTACAAGACAG GTACATCACATCCCTACTCTGTTTTCTCTTGATTCTAGTACGTCACATCCCTTCAATGTTTTCTCTTGAATAA
AA sequence Show only first row Show all	>Potri.005G004100.3 pacid=42802990 polypeptide=Potri.005G004100.3.p locus=Potri.005G004100 ID=Potri.005G004100.3.v4.1 annot-version=v4.1 MGFFSFIRRLMLILFGTANDLVFLSFSNEDTGKNFSDHLNSALTIAGFRTFKNDDGVRRGENTGSETRKAIQESKISVIVFSKDYASSTRCLDELVMIMD ARRATGHIVLPIFYHLDPSEVRSQEGRCFEAFSTHEKSFQGEKGRVEEWRAALREAADVAGMVLQDRYITSLLCFLLILVRHIPSMFSLE

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G27170			transmembrane receptors;ATP bi...		Potri.005G004100 [exp]	0	1
AT5G02220			unknown protein		Potri.010G201900 [exp]	3.00	0.8916
AT4G23420			NAD(P)-binding Rossmann-fold s...		Potri.003G128800 [exp]	4.00	0.8920
AT3G52490			Double Clp-N motif-containing ...		Potri.006G204500 [exp]	4.79	0.8940
AT3G24330			O-Glycosyl hydrolases family 1...		Potri.018G072300 [exp]	5.91	0.8881
AT5G06740			Concanavalin A-like lectin pro...		Potri.011G146500 [exp]	7.07	0.8733
					Potri.006G044200 [exp]	9.89	0.8668
AT5G05830			RING/FYVE/PHD zinc finger supe...		Potri.016G105900 [exp]	11.66	0.8658
AT4G00900		ATECA2, ECA2	ER-type Ca2+-ATPase 2, ARABIDO...		Potri.014G101900 [exp]	13.74	0.8597	Pt-ECA2.1
AT1G14370		Kin1, PBL2, APK...	PBS1-like 2, kinase 1, protein...		Potri.009G020700 [exp]	16.24	0.8582
AT2G38450			unknown protein		Potri.016G128700 [exp]	19.05	0.8496

Compare expression of checked genes

Potri.005G004100 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.