Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G63320 73 / 1e-17 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT1G63080 69 / 2e-15 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT1G12700 67 / 1e-14 RPF1 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) AT3G22470 67 / 2e-14 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT1G12620 67 / 2e-14 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT1G12300 67 / 2e-14 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT1G12775 64 / 1e-13 Pentatricopeptide repeat (PPR) superfamily protein (.1) AT1G63130 64 / 1e-13 Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT1G62930 62 / 6e-13 RPF3 RNA processing factor 3, Tetratricopeptide repeat (TPR)-like superfamily protein (.1) AT1G63330 60 / 3e-12 Pentatricopeptide repeat (PPR) superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.005G050060 [exp] 144 / 2e-45 AT1G12700 146 / 8e-41 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Potri.005G046200 [exp] 152 / 3e-45 AT1G12700 501 / 5e-170 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Potri.005G047400 [exp] 150 / 9e-45 AT1G63080 341 / 1e-110 Pentatricopeptide repeat (PPR) superfamily protein (.1) Potri.005G045000 [exp] 150 / 1e-44 AT1G12700 502 / 4e-170 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Potri.005G050400 [exp] 150 / 1e-44 AT1G12700 504 / 3e-171 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Potri.005G050500 [exp] 149 / 7e-44 AT1G12700 523 / 2e-178 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Potri.005G050240 [exp] 147 / 2e-43 AT1G12700 465 / 1e-155 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Potri.005G050180 [exp] 147 / 2e-43 AT1G12700 488 / 2e-164 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Potri.005G038400 [exp] 144 / 4e-42 AT1G12700 478 / 7e-161 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10014245 [exp] 85 / 7e-21 AT1G12700 427 / 5e-141 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Lus10003429 [exp] 83 / 9e-21 AT1G62930 173 / 1e-49 RNA processing factor 3, Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10003446 [exp] 81 / 2e-20 AT1G62930 137 / 2e-37 RNA processing factor 3, Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10003433 [exp] 83 / 4e-20 AT1G12700 396 / 2e-129 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Lus10003447 [exp] 83 / 4e-20 AT1G12700 202 / 1e-56 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Lus10022861 [exp] 82 / 1e-19 AT1G12700 370 / 7e-121 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Lus10008593 [exp] 81 / 1e-19 AT1G12700 400 / 7e-131 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Lus10014244 [exp] 79 / 7e-19 AT1G12700 397 / 7e-130 RNA processing factor 1, ATP binding;nucleic acid binding;helicases (.1) Lus10014247 [exp] 78 / 2e-18 AT1G62930 340 / 3e-109 RNA processing factor 3, Tetratricopeptide repeat (TPR)-like superfamily protein (.1) Lus10003426 [exp] 73 / 3e-18 AT3G22470 82 / 2e-19 Pentatricopeptide repeat (PPR) superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0020 [poplar] [flax] TPR PF13041 [poplar] [flax] PPR_2 PPR repeat family
Representative CDS sequence Show only first row Show all	>Potri.005G046050.1 pacid=42805107 polypeptide=Potri.005G046050.1.p locus=Potri.005G046050 ID=Potri.005G046050.1.v4.1 annot-version=v4.1 ATGATCAAGGGACTTCCTAGAGAAGGGCAGTCAGATGAAGCATACAAATTGTTTCGAAAAATGAAAGACGAGGGCTTCTTGCCGGATAGTTGCTCTTATA ATGTTATCATTCAAGGATTTCTTCAAAATCAGGACTCATCAACTGCTATACGACTTATTGATGAAATGGTTGGTAAAAGATTCTCGGCAGATTCATCTAC ATTTCAGATGTTATTAGATCTGGAATCTCGTGATGAAATCATAAGCTGA
AA sequence Show only first row Show all	>Potri.005G046050.1 pacid=42805107 polypeptide=Potri.005G046050.1.p locus=Potri.005G046050 ID=Potri.005G046050.1.v4.1 annot-version=v4.1 MIKGLPREGQSDEAYKLFRKMKDEGFLPDSCSYNVIIQGFLQNQDSSTAIRLIDEMVGKRFSADSSTFQMLLDLESRDEIIS

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G63320			Pentatricopeptide repeat (PPR)...		Potri.005G046050 [exp]	0	1
AT1G11580		ATPMEPCRA	methylesterase PCR A (.1)		Potri.004G020800 [exp]	14.38	0.7301
					Potri.017G045800 [exp]	32.49	0.7177
					Potri.017G046100 [exp]	98.49	0.6594
AT1G20560		AAE1	acyl activating enzyme 1 (.1.2...		Potri.002G010600 [exp]	121.47	0.6526
AT2G24960			unknown protein		Potri.017G120900 [exp]	131.85	0.6402
					Potri.017G045600 [exp]	135.21	0.6505
AT5G19130			GPI transamidase component fam...		Potri.001G345200 [exp]	137.70	0.6258
AT5G52552		CPuORF14	conserved peptide upstream ope...		Potri.017G143300 [exp]	141.30	0.6088
AT5G06990			Protein of unknown function, D...		Potri.001G031900 [exp]	152.57	0.6293
AT5G50011		CPuORF37	conserved peptide upstream ope...		Potri.005G158000 [exp]	174.26	0.6039

Compare expression of checked genes

Potri.005G046050 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.