Potri.005G119400 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT1G75388 62 / 2e-15 CPuORF5 conserved peptide upstream open reading frame 5 (.1)
AT2G18162 61 / 4e-15 CPuORF1 conserved peptide upstream open reading frame 1 (.1)
AT4G34588 57 / 3e-13 CPuORF2 conserved peptide upstream open reading frame 2 (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.007G020000 71 / 5e-19 AT1G75388 69 / 2e-18 conserved peptide upstream open reading frame 5 (.1)
Potri.002G032000 66 / 4e-17 AT1G75388 76 / 5e-21 conserved peptide upstream open reading frame 5 (.1)
Potri.005G231250 64 / 2e-16 AT1G75388 74 / 7e-20 conserved peptide upstream open reading frame 5 (.1)
Potri.009G119650 57 / 1e-13 AT4G34588 72 / 2e-19 conserved peptide upstream open reading frame 2 (.1)
Potri.004G158150 56 / 4e-13 AT4G34588 71 / 5e-19 conserved peptide upstream open reading frame 2 (.1)
Flax homologues

No hit found

PFAM info
Representative CDS sequence
>Potri.005G119400.1 pacid=42802688 polypeptide=Potri.005G119400.1.p locus=Potri.005G119400 ID=Potri.005G119400.1.v4.1 annot-version=v4.1
ATGACTCCTGTCCTCTGTGAAATCCTCCTCTCTGGTTTTATGATACACTCTACTCGTAGACGCAGGATCACTCACCTTGTTCAATCTTTCTCTGTTGTTT
TCCTCTACTGGTTCTACGTTTTCTCATGA
AA sequence
>Potri.005G119400.1 pacid=42802688 polypeptide=Potri.005G119400.1.p locus=Potri.005G119400 ID=Potri.005G119400.1.v4.1 annot-version=v4.1
MTPVLCEILLSGFMIHSTRRRRITHLVQSFSVVFLYWFYVFS

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT1G75388 CPuORF5 conserved peptide upstream ope... Potri.005G119400 0 1
AT3G63010 ATGID1B, GID1B GA INSENSITIVE DWARF1B, alpha/... Potri.002G213100 3.74 0.8926
AT3G04070 NAC ANAC047 NAC domain containing protein ... Potri.019G031400 4.24 0.8732
Potri.009G055800 5.47 0.8860
AT1G14370 Kin1, PBL2, APK... PBS1-like 2, kinase 1, protein... Potri.009G020700 5.91 0.8674
AT2G29420 GST25, ATGSTU7 GLUTATHIONE S-TRANSFERASE 25, ... Potri.010G070900 6.32 0.8554
Potri.005G129350 6.63 0.8716
AT2G18160 bZIP GBF5, ATBZIP2 G-BOX BINDING FACTOR 5, basic ... Potri.005G119300 6.70 0.8423
AT1G28190 unknown protein Potri.003G160000 10.39 0.8523
AT3G14470 NB-ARC domain-containing disea... Potri.017G121700 15.09 0.8131
AT5G24860 ATFPF1, FPF1 ARABIDOPSIS FLOWERING PROMOTIN... Potri.008G209300 16.30 0.8426

Potri.005G119400 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.