Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G43580 74 / 4e-19 UPI UNUSUAL SERINE PROTEASE INHIBITOR, Serine protease inhibitor, potato inhibitor I-type family protein (.1) AT2G38900 71 / 3e-18 Serine protease inhibitor, potato inhibitor I-type family protein (.1.2) AT2G38870 71 / 3e-18 Serine protease inhibitor, potato inhibitor I-type family protein (.1) AT5G43570 61 / 5e-14 Serine protease inhibitor, potato inhibitor I-type family protein (.1) AT3G46860 56 / 3e-12 Serine protease inhibitor, potato inhibitor I-type family protein (.1) AT3G50020 38 / 7e-05 Serine protease inhibitor, potato inhibitor I-type family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.011G110100 [exp] 119 / 2e-37 AT5G43580 78 / 1e-20 UNUSUAL SERINE PROTEASE INHIBITOR, Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.011G110400 [exp] 119 / 4e-37 AT5G43580 78 / 1e-20 UNUSUAL SERINE PROTEASE INHIBITOR, Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.010G075800 [exp] 81 / 4e-22 AT2G38870 76 / 3e-20 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.010G075200 [exp] 80 / 1e-21 AT2G38870 76 / 4e-20 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.010G075600 [exp] 77 / 1e-20 AT5G43580 80 / 3e-21 UNUSUAL SERINE PROTEASE INHIBITOR, Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.010G075300 [exp] 76 / 6e-20 AT5G43580 77 / 2e-20 UNUSUAL SERINE PROTEASE INHIBITOR, Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.010G075501 [exp] 76 / 6e-20 AT5G43580 77 / 2e-20 UNUSUAL SERINE PROTEASE INHIBITOR, Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.009G028300 [exp] 75 / 1e-19 AT5G43580 76 / 7e-20 UNUSUAL SERINE PROTEASE INHIBITOR, Serine protease inhibitor, potato inhibitor I-type family protein (.1) Potri.006G212000 [exp] 74 / 2e-19 AT2G38870 81 / 5e-22 Serine protease inhibitor, potato inhibitor I-type family protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10018783 [exp] 72 / 2e-18 AT2G38870 89 / 2e-25 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Lus10032655 [exp] 75 / 2e-17 AT1G52870 499 / 3e-176 Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein (.1), Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein (.2) Lus10002732 [exp] 69 / 2e-17 AT2G38870 76 / 4e-20 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Lus10018784 [exp] 69 / 4e-17 AT2G38870 89 / 1e-25 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Lus10043097 [exp] 72 / 2e-16 AT1G52870 505 / 2e-179 Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein (.1), Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein (.2) Lus10014740 [exp] 64 / 2e-15 AT2G38870 77 / 2e-20 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Lus10018786 [exp] 64 / 3e-15 AT2G38870 93 / 6e-27 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Lus10024870 [exp] 62 / 1e-14 AT2G38870 94 / 2e-27 Serine protease inhibitor, potato inhibitor I-type family protein (.1) Lus10010859 [exp] 49 / 3e-09 AT2G38900 47 / 3e-08 Serine protease inhibitor, potato inhibitor I-type family protein (.1.2) Lus10024370 [exp] 46 / 7e-08 AT2G38870 47 / 3e-08 Serine protease inhibitor, potato inhibitor I-type family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0367 [poplar] [flax] CI-2 PF00280 [poplar] [flax] potato_inhibit Potato inhibitor I family
Representative CDS sequence Show only first row Show all	>Potri.005G221000.1 pacid=42802743 polypeptide=Potri.005G221000.1.p locus=Potri.005G221000 ID=Potri.005G221000.1.v4.1 annot-version=v4.1 ATGACAGATGTTTGCTCTGATACTGGAAAGAGTTCGTGGCCGGAGCTAGTGGGAATAAACGGAGAAGTGGCAGCAAAAATCATCGAGAGCGAAAATCCCA AGGTTCGTGTTTCGATTGTGGAGGAAGGAATGATGGTGACCCAGGAAATCCGTTGCGACAGGGTCCGAGTCTGGGTTGATAAAAATGGAATTGTGAAAGA TATTCCATCGATTCGTTGA
AA sequence Show only first row Show all	>Potri.005G221000.1 pacid=42802743 polypeptide=Potri.005G221000.1.p locus=Potri.005G221000 ID=Potri.005G221000.1.v4.1 annot-version=v4.1 MTDVCSDTGKSSWPELVGINGEVAAKIIESENPKVRVSIVEEGMMVTQEIRCDRVRVWVDKNGIVKDIPSIR

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G43580		UPI	UNUSUAL SERINE PROTEASE INHIBI...		Potri.005G221000 [exp]	0	1
AT3G50610			unknown protein		Potri.005G136700 [exp]	1.41	0.9149
AT5G39130			RmlC-like cupins superfamily p...		Potri.013G063101 [exp]	8.12	0.9146
AT5G39130			RmlC-like cupins superfamily p...		Potri.013G062950 [exp]	11.22	0.9092
AT4G12430		TPPF	trehalose-6-phosphate phosphat...		Potri.003G112400 [exp]	11.61	0.8659
AT5G39130			RmlC-like cupins superfamily p...		Potri.013G063051 [exp]	12.12	0.9081
AT5G39130			RmlC-like cupins superfamily p...		Potri.013G064100 [exp]	17.60	0.9026
AT5G39130			RmlC-like cupins superfamily p...		Potri.004G179888 [exp]	18.00	0.7976
AT5G39130			RmlC-like cupins superfamily p...		Potri.013G063050 [exp]	18.16	0.8998
AT5G39130			RmlC-like cupins superfamily p...		Potri.013G063100 [exp]	18.65	0.8932
AT5G39130			RmlC-like cupins superfamily p...		Potri.013G063200 [exp]	18.73	0.8914

Compare expression of checked genes

Potri.005G221000 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.