Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G42785 56 / 3e-11 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G034300 [exp] 125 / 4e-39 AT5G42785 59 / 2e-12 unknown protein
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10001961 [exp] 69 / 1e-16 AT5G42785 62 / 8e-14 unknown protein Lus10002541 [exp] 60 / 8e-13 AT5G42785 46 / 3e-07 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.005G228800.2 pacid=42805535 polypeptide=Potri.005G228800.2.p locus=Potri.005G228800 ID=Potri.005G228800.2.v4.1 annot-version=v4.1 ATGAGTGGGAGGATTTTTCTAGTGATTTTCTTCTTCTGGGCTCTCCTCGCAATTGTCACCCCCACACTTGTTCTCTTGTCAGAATCTTCAAAGCCATACT TGGATGATGTTGAGAAGAGTGAAGGATTACTGAAGCTTAGGAGAATGATGGGAAGCTTGGAGAAACAACCAAGAGTACAAGAAATAGCCCTGGCACCAAT TTTGCAGGCGCCGACACCAGCTCCAGACCCGGAGCCAGATTCTGGAATCCGAGAGGCTATTTTGACAAGGGTTCTTAAGAATGGATGA
AA sequence Show only first row Show all	>Potri.005G228800.2 pacid=42805535 polypeptide=Potri.005G228800.2.p locus=Potri.005G228800 ID=Potri.005G228800.2.v4.1 annot-version=v4.1 MSGRIFLVIFFFWALLAIVTPTLVLLSESSKPYLDDVEKSEGLLKLRRMMGSLEKQPRVQEIALAPILQAPTPAPDPEPDSGIREAILTRVLKNG

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G42785			unknown protein		Potri.005G228800 [exp]	0	1
AT1G71870			MATE efflux family protein (.1...		Potri.013G115600 [exp]	4.24	0.7968
AT4G31500		SUR2, RNT1, RED...	SUPERROOT 2, RUNT 1, RED ELONG...		Potri.002G026100 [exp]	4.69	0.8124
AT4G39140			RING/U-box superfamily protein...		Potri.009G120000 [exp]	5.09	0.7699
AT4G31500		SUR2, RNT1, RED...	SUPERROOT 2, RUNT 1, RED ELONG...		Potri.002G025425 [exp]	8.00	0.8009
AT3G48660			Protein of unknown function (D...		Potri.015G098300 [exp]	8.48	0.7960
AT1G02630			Nucleoside transporter family ...		Potri.018G130000 [exp]	10.09	0.7878
					Potri.010G076150 [exp]	14.14	0.7840
AT2G01430	HD	ATHB17, ATHB-17	ARABIDOPSIS THALIANA HOMEOBOX-...		Potri.010G112600 [exp]	14.28	0.7173
AT1G42540		ATGLR3.3	glutamate receptor 3.3 (.1)		Potri.002G007400 [exp]	15.49	0.7781	GLR3.2
AT1G26610	C2H2ZnF		C2H2-like zinc finger protein ...		Potri.010G159600 [exp]	20.49	0.6641

Compare expression of checked genes

Potri.005G228800 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.