Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G74360 53 / 2e-09 Leucine-rich repeat protein kinase family protein (.1) AT4G08850 52 / 6e-09 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) AT4G20140 52 / 9e-09 GSO1 GASSHO1, Leucine-rich repeat transmembrane protein kinase (.1) AT2G23450 51 / 2e-08 Protein kinase superfamily protein (.1.2) AT5G63930 50 / 2e-08 Leucine-rich repeat protein kinase family protein (.1) AT1G35710 50 / 3e-08 Protein kinase family protein with leucine-rich repeat domain (.1) AT4G04500 50 / 4e-08 CRK37 cysteine-rich RLK (RECEPTOR-like protein kinase) 37 (.1) AT4G04510 49 / 6e-08 CRK38 cysteine-rich RLK (RECEPTOR-like protein kinase) 38 (.1) AT1G76370 49 / 7e-08 Protein kinase superfamily protein (.1) AT5G44700 49 / 7e-08 GSO2, EDA23 GASSHO 2, EMBRYO SAC DEVELOPMENT ARREST 23, Leucine-rich repeat transmembrane protein kinase (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.002G007925 [exp] 111 / 9e-30 AT4G08850 518 / 1e-168 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) Potri.002G008375 [exp] 106 / 6e-28 AT4G08850 557 / 0.0 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) Potri.002G008175 [exp] 104 / 3e-27 AT4G08850 566 / 0.0 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) Potri.002G008100 [exp] 104 / 3e-27 AT4G08850 565 / 0.0 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) Potri.002G008450 [exp] 97 / 1e-24 AT4G08850 462 / 9e-150 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) Potri.015G123700 [exp] 74 / 2e-16 AT4G08850 688 / 0.0 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) Potri.015G123800 [exp] 73 / 4e-16 AT4G08850 751 / 0.0 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) Potri.015G123400 [exp] 72 / 4e-16 AT4G08850 708 / 0.0 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) Potri.015G122900 [exp] 72 / 4e-16 AT4G08850 667 / 0.0 Leucine-rich repeat receptor-like protein kinase family protein (.1.2)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10008712 [exp] 64 / 5e-13 AT4G08850 1009 / 0.0 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) Lus10020935 [exp] 64 / 6e-13 AT4G08850 1011 / 0.0 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) Lus10020936 [exp] 62 / 2e-12 AT4G08850 793 / 0.0 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) Lus10003612 [exp] 61 / 5e-12 AT1G35710 751 / 0.0 Protein kinase family protein with leucine-rich repeat domain (.1) Lus10019036 [exp] 58 / 8e-11 AT4G08850 891 / 0.0 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) Lus10036251 [exp] 57 / 1e-10 AT4G20140 1495 / 0.0 GASSHO1, Leucine-rich repeat transmembrane protein kinase (.1) Lus10004046 [exp] 56 / 2e-10 AT4G08850 773 / 0.0 Leucine-rich repeat receptor-like protein kinase family protein (.1.2) Lus10002293 [exp] 54 / 1e-09 AT1G35710 781 / 0.0 Protein kinase family protein with leucine-rich repeat domain (.1) Lus10038392 [exp] 54 / 1e-09 AT4G20140 1376 / 0.0 GASSHO1, Leucine-rich repeat transmembrane protein kinase (.1) Lus10005015 [exp] 54 / 2e-09 AT4G08850 223 / 3e-66 Leucine-rich repeat receptor-like protein kinase family protein (.1.2)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.005G253301.1 pacid=42803933 polypeptide=Potri.005G253301.1.p locus=Potri.005G253301 ID=Potri.005G253301.1.v4.1 annot-version=v4.1 ATGAAGACTTATTTTCCATACGAAGACATCATTGCAGCGACGGAGGACCTTGACCTCAAATATTGTATCGGATCCACTGGTTATGGGAGTGTCTACAAGG CACAACTTCCAAGTGCACAAGTAGTTGCCTTGAAGAAACTTCATCATCGAGAGGCAGAGGAGCATGGTTTTAACAAGAGTTTCAAGAATGAGGTGAAACT GCTCACAAGCTTTATGGATTTTGTGTACACCAACGAAGCATGTTTCTTGTTTACAAGTCCATGGAAAGGGGAAGAACAGGATCAAAGACAGTGCTCACCC GTTATCTTTTTTGCATCATGA
AA sequence Show only first row Show all	>Potri.005G253301.1 pacid=42803933 polypeptide=Potri.005G253301.1.p locus=Potri.005G253301 ID=Potri.005G253301.1.v4.1 annot-version=v4.1 MKTYFPYEDIIAATEDLDLKYCIGSTGYGSVYKAQLPSAQVVALKKLHHREAEEHGFNKSFKNEVKLLTSFMDFVYTNEACFLFTSPWKGEEQDQRQCSP VIFFAS

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT4G08850			Leucine-rich repeat receptor-l...		Potri.005G253301 [exp]	0	1
AT2G03380			Pentatricopeptide repeat (PPR)...		Potri.010G161800 [exp]	45.25	0.4651
AT4G24220		5[beta]-StR, 5[...	VEIN PATTERNING 1, Δ4,5-s...		Potri.009G091950 [exp]	58.34	0.4070
					Potri.004G065750 [exp]	141.30	0.3876
AT3G04900			Heavy metal transport/detoxifi...		Potri.009G126600 [exp]	153.08	0.3731
AT1G29660			GDSL-like Lipase/Acylhydrolase...		Potri.012G060700 [exp]	162.26	0.3665

Compare expression of checked genes

Potri.005G253301 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.