Potri.006G049000 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT3G21090 58 / 3e-11 ABCG15 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
AT1G51500 56 / 2e-10 AtABCG12, WBC12, ABCG12, D3, CER5, ATWBC12 ECERIFERUM 5, ARABIDOPSIS THALIANA WHITE-BROWN COMPLEX 12, ATP-binding cassette G12, ABC-2 type transporter family protein (.1)
AT1G51460 54 / 9e-10 ABCG13 ATP-binding cassette G13, ABC-2 type transporter family protein (.1)
AT2G01320 50 / 3e-08 ABCG7 ATP-binding cassette G7, ABC-2 type transporter family protein (.1.2.3.4)
AT1G17840 45 / 1e-06 AtABCG11, WBC11, DSO, ABCG11 ,COF1, ATWBC11 DESPERADO, CUTICULAR DEFECT AND ORGAN FUSION 1, ARABIDOPSIS THALIANA WHITE-BROWN COMPLEX HOMOLOG PROTEIN 11, ATP-binding cassette G11, white-brown complex homolog protein 11 (.1)
AT2G28070 42 / 1e-05 ABCG3 ATP-binding cassette G3, ABC-2 type transporter family protein (.1)
AT1G71960 42 / 1e-05 ATABCG25, ABCG25 Arabidopsis thaliana ATP-binding cassette G25, ATP-binding casette G25, ATP-binding casette family G25 (.1)
AT3G52310 42 / 1e-05 ABCG27 ATP-binding cassette G27, ABC-2 type transporter family protein (.1)
AT1G53390 41 / 3e-05 ABCG24 ATP-binding cassette G24, P-loop containing nucleoside triphosphate hydrolases superfamily protein (.1)
AT2G37010 40 / 5e-05 ATNAP12 non-intrinsic ABC protein 12 (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.016G056600 73 / 1e-16 AT3G21090 744 / 0.0 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
Potri.016G056700 56 / 2e-10 AT3G21090 739 / 0.0 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
Potri.009G051300 56 / 2e-10 AT3G21090 943 / 0.0 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
Potri.001G255900 54 / 1e-09 AT3G21090 929 / 0.0 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
Potri.009G051200 54 / 1e-09 AT3G21090 1008 / 0.0 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
Potri.010G115000 53 / 2e-09 AT2G01320 1047 / 0.0 ATP-binding cassette G7, ABC-2 type transporter family protein (.1.2.3.4)
Potri.001G255800 52 / 6e-09 AT3G21090 1038 / 0.0 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
Potri.005G073100 49 / 6e-08 AT1G17840 661 / 0.0 DESPERADO, CUTICULAR DEFECT AND ORGAN FUSION 1, ARABIDOPSIS THALIANA WHITE-BROWN COMPLEX HOMOLOG PROTEIN 11, ATP-binding cassette G11, white-brown complex homolog protein 11 (.1)
Potri.005G073050 49 / 7e-08 AT1G17840 659 / 0.0 DESPERADO, CUTICULAR DEFECT AND ORGAN FUSION 1, ARABIDOPSIS THALIANA WHITE-BROWN COMPLEX HOMOLOG PROTEIN 11, ATP-binding cassette G11, white-brown complex homolog protein 11 (.1)
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10009960 58 / 4e-11 AT3G21090 855 / 0.0 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
Lus10027354 57 / 7e-11 AT3G21090 868 / 0.0 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
Lus10000339 54 / 1e-09 AT1G51460 837 / 0.0 ATP-binding cassette G13, ABC-2 type transporter family protein (.1)
Lus10000338 52 / 5e-09 AT3G21090 532 / 0.0 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
Lus10009961 52 / 5e-09 AT3G21090 971 / 0.0 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
Lus10027353 52 / 6e-09 AT3G21090 661 / 0.0 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
Lus10009959 50 / 2e-08 AT3G21090 860 / 0.0 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
Lus10035445 49 / 4e-08 AT3G21090 667 / 0.0 ATP-binding cassette G15, ABC-2 type transporter family protein (.1)
Lus10042949 49 / 4e-08 AT2G01320 1062 / 0.0 ATP-binding cassette G7, ABC-2 type transporter family protein (.1.2.3.4)
Lus10032449 49 / 5e-08 AT2G01320 1037 / 0.0 ATP-binding cassette G7, ABC-2 type transporter family protein (.1.2.3.4)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0023 P-loop_NTPase PF13555 AAA_29 P-loop containing region of AAA domain
Representative CDS sequence
>Potri.006G049000.2 pacid=42770170 polypeptide=Potri.006G049000.2.p locus=Potri.006G049000 ID=Potri.006G049000.2.v4.1 annot-version=v4.1
ATGAAGATTCAAGAGAGGGAGAAGGAAGAGCAGTCGGAGTCCAGTAGTATTAGAGAAAAGAAAGCAATGCATACATCTGATATGGGAAGATGGAACCGTA
GTACTGGTGGCTATCAACTTGAAAAGAAAAGTGGTGGTGCGCCTAGGAAGTTGCTAAATAGGCAAGGTGGTTATGCTGTACCTGATCGGATCACGGCCAT
TATGGGTCCTTCTGGCTCAGGCAAATCCACCTTACTTGATGCATTTGCAGGTGTTTTAGTGAACTCAAATATTACTGTTCTTCACCGTTAA
AA sequence
>Potri.006G049000.2 pacid=42770170 polypeptide=Potri.006G049000.2.p locus=Potri.006G049000 ID=Potri.006G049000.2.v4.1 annot-version=v4.1
MKIQEREKEEQSESSSIREKKAMHTSDMGRWNRSTGGYQLEKKSGGAPRKLLNRQGGYAVPDRITAIMGPSGSGKSTLLDAFAGVLVNSNITVLHR

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT3G21090 ABCG15 ATP-binding cassette G15, ABC-... Potri.006G049000 0 1
AT2G31470 DOR DROUGHT TOLERANCE REPRESSOR, F... Potri.001G458400 3.31 0.8702
AT3G52210 S-adenosyl-L-methionine-depend... Potri.010G233100 4.89 0.8700
AT3G04880 DRT102 DNA-DAMAGE-REPAIR/TOLERATION 2... Potri.005G050600 8.71 0.8541 Pt-DRT102.2
AT3G25910 Protein of unknown function (D... Potri.003G060800 10.95 0.8916
AT1G24290 AAA-type ATPase family protein... Potri.011G023800 12.04 0.8366
Potri.009G016766 12.96 0.8867
AT3G12640 RNA binding (RRM/RBD/RNP motif... Potri.001G269200 13.74 0.8519
AT5G62380 NAC ANAC101, VND6 VASCULAR-RELATED NAC-DOMAIN 6,... Potri.006G231300 15.49 0.8717
AT1G03220 Eukaryotic aspartyl protease f... Potri.006G068900 15.87 0.8822
AT1G78160 APUM7 pumilio 7 (.1) Potri.002G095400 17.49 0.8109

Potri.006G049000 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.