Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G01650 199 / 6e-68 Tautomerase/MIF superfamily protein (.1.2) AT5G57170 145 / 1e-46 Tautomerase/MIF superfamily protein (.1.2) AT3G51660 114 / 2e-34 Tautomerase/MIF superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.016G126500 [exp] 209 / 1e-71 AT5G01650 193 / 2e-65 Tautomerase/MIF superfamily protein (.1.2) Potri.016G126600 [exp] 196 / 2e-66 AT5G01650 216 / 2e-74 Tautomerase/MIF superfamily protein (.1.2) Potri.016G126800 [exp] 193 / 3e-65 AT5G01650 185 / 4e-62 Tautomerase/MIF superfamily protein (.1.2) Potri.006G104600 [exp] 184 / 9e-62 AT5G01650 180 / 3e-60 Tautomerase/MIF superfamily protein (.1.2) Potri.016G126700 [exp] 172 / 7e-57 AT5G01650 164 / 6e-54 Tautomerase/MIF superfamily protein (.1.2) Potri.006G075100 [exp] 146 / 1e-46 AT5G57170 194 / 7e-66 Tautomerase/MIF superfamily protein (.1.2) Potri.006G104800 [exp] 129 / 3e-40 AT3G51660 151 / 7e-49 Tautomerase/MIF superfamily protein (.1) Potri.016G127300 [exp] 128 / 8e-40 AT3G51660 151 / 7e-49 Tautomerase/MIF superfamily protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10022681 [exp] 169 / 1e-55 AT5G01650 172 / 8e-57 Tautomerase/MIF superfamily protein (.1.2) Lus10014233 [exp] 161 / 1e-52 AT5G01650 169 / 1e-55 Tautomerase/MIF superfamily protein (.1.2) Lus10012223 [exp] 135 / 1e-42 AT5G01650 146 / 9e-47 Tautomerase/MIF superfamily protein (.1.2) Lus10012222 [exp] 129 / 1e-39 AT3G51660 158 / 1e-51 Tautomerase/MIF superfamily protein (.1) Lus10033324 [exp] 94 / 2e-25 AT5G57170 119 / 1e-35 Tautomerase/MIF superfamily protein (.1.2) Lus10034783 [exp] 92 / 9e-25 AT5G57170 116 / 4e-34 Tautomerase/MIF superfamily protein (.1.2) Lus10000344 [exp] 82 / 1e-21 AT3G51660 96 / 2e-27 Tautomerase/MIF superfamily protein (.1) Lus10000345 [exp] 0 / 1 AT5G01650 52 / 2e-11 Tautomerase/MIF superfamily protein (.1.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0082 [poplar] [flax] MIF PF01187 [poplar] [flax] MIF Macrophage migration inhibitory factor (MIF)
Representative CDS sequence Show only first row Show all	>Potri.006G104500.2 pacid=42767085 polypeptide=Potri.006G104500.2.p locus=Potri.006G104500 ID=Potri.006G104500.2.v4.1 annot-version=v4.1 ATGCCTTGCTTGAACATTTCAACCAACGTTAATCTCGATGGCGTCAACACATCCGCCATCCTCTCTGAAGCCTCTTCTCAAGTGGCCAAAATCATCGGCA AACCTGAGTCCTATGTGATGATTGTGTTGAAGGGCTCAGTACCAATTGCATTTGGAGGAACTGAGCAGCCAGCAGCTTATGGTGAGTTGGTATCTGTTGG TGGCCTTAGCGGTGATGTGAACAAGAAACTGAGTTCTGCAATTGCTACCATTCTTGAGTCGAAGCTGTCGGTGCCCAAGTCACGGTTCTTCCTCAAATTT TTTGATTCCAAGGGATCCCACTTTGGATGGAATGGTTCCACCTTCTAA
AA sequence Show only first row Show all	>Potri.006G104500.2 pacid=42767085 polypeptide=Potri.006G104500.2.p locus=Potri.006G104500 ID=Potri.006G104500.2.v4.1 annot-version=v4.1 MPCLNISTNVNLDGVNTSAILSEASSQVAKIIGKPESYVMIVLKGSVPIAFGGTEQPAAYGELVSVGGLSGDVNKKLSSAIATILESKLSVPKSRFFLKF FDSKGSHFGWNGSTF

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G01650			Tautomerase/MIF superfamily pr...		Potri.006G104500 [exp]	0	1
AT2G25310			Protein of unknown function (D...		Potri.006G257100 [exp]	1.41	0.9326
AT3G07480			2Fe-2S ferredoxin-like superfa...		Potri.014G177100 [exp]	5.65	0.9269
AT1G19580		GAMMACA1 ,GAMMA...	gamma carbonic anhydrase 1 (.1...		Potri.005G229000 [exp]	6.92	0.9206	APFI.2
AT5G14030			translocon-associated protein ...		Potri.001G323400 [exp]	10.24	0.9271
AT5G52840			NADH-ubiquinone oxidoreductase...		Potri.004G071900 [exp]	10.24	0.9243
AT2G22425			Microsomal signal peptidase 12...		Potri.008G175775 [exp]	10.48	0.9186
AT5G02280			SNARE-like superfamily protein...		Potri.009G069800 [exp]	10.95	0.9180
AT5G48580		FKBP15-2	FK506- and rapamycin-binding p...		Potri.002G248200 [exp]	12.72	0.9202
AT1G73230			Nascent polypeptide-associated...		Potri.012G037900 [exp]	13.78	0.9259
AT5G05370			Cytochrome b-c1 complex, subun...		Potri.019G132000 [exp]	14.28	0.9139

Compare expression of checked genes

Potri.006G104500 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.