Potri.006G131200 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT2G35795 195 / 2e-66 Chaperone DnaJ-domain superfamily protein (.1)
AT5G03030 176 / 8e-59 Chaperone DnaJ-domain superfamily protein (.1)
AT3G09700 168 / 2e-55 Chaperone DnaJ-domain superfamily protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.008G043500 174 / 7e-58 AT2G35795 179 / 4e-60 Chaperone DnaJ-domain superfamily protein (.1)
Potri.012G038800 166 / 1e-54 AT2G35795 160 / 3e-52 Chaperone DnaJ-domain superfamily protein (.1)
Potri.014G151200 42 / 7e-06 AT3G59280 187 / 7e-63 THAXTOMIN A RESISTANT 1, Protein Transporter, Pam16 (.1)
Potri.010G243100 39 / 0.0002 AT3G44110 528 / 0.0 DNAJ homologue 3 (.1.2)
Potri.008G018800 39 / 0.0003 AT3G44110 528 / 0.0 DNAJ homologue 3 (.1.2)
Potri.001G347600 39 / 0.0004 AT5G23240 149 / 2e-41 DNAJ heat shock N-terminal domain-containing protein (.1)
Potri.009G015700 38 / 0.0006 AT3G44110 629 / 0.0 DNAJ homologue 3 (.1.2)
Potri.002G141100 38 / 0.0006 AT3G44110 504 / 3e-178 DNAJ homologue 3 (.1.2)
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10041420 171 / 6e-56 AT2G35795 194 / 2e-65 Chaperone DnaJ-domain superfamily protein (.1)
Lus10040376 173 / 4e-54 AT5G03030 184 / 6e-58 Chaperone DnaJ-domain superfamily protein (.1)
Lus10036507 143 / 3e-45 AT2G35795 163 / 3e-53 Chaperone DnaJ-domain superfamily protein (.1)
Lus10023494 137 / 6e-44 AT5G03030 135 / 3e-43 Chaperone DnaJ-domain superfamily protein (.1)
Lus10015065 115 / 5e-35 AT2G35795 118 / 3e-36 Chaperone DnaJ-domain superfamily protein (.1)
Lus10019915 122 / 1e-33 AT5G28540 321 / 2e-101 heat shock protein 70 (Hsp 70) family protein (.1)
Lus10026485 114 / 6e-33 AT1G09080 124 / 2e-36 binding protein 3, Heat shock protein 70 (Hsp 70) family protein (.1), Heat shock protein 70 (Hsp 70) family protein (.2)
Lus10042891 42 / 2e-05 AT5G22060 554 / 0.0 ARABIDOPSIS THALIANA DNAJ HOMOLOGUE 2, DNAJ homologue 2 (.1)
Lus10028188 42 / 2e-05 AT5G22060 563 / 0.0 ARABIDOPSIS THALIANA DNAJ HOMOLOGUE 2, DNAJ homologue 2 (.1)
Lus10008652 40 / 0.0001 AT5G22060 300 / 5e-100 ARABIDOPSIS THALIANA DNAJ HOMOLOGUE 2, DNAJ homologue 2 (.1)
PFAM info
Representative CDS sequence
>Potri.006G131200.1 pacid=42769887 polypeptide=Potri.006G131200.1.p locus=Potri.006G131200 ID=Potri.006G131200.1.v4.1 annot-version=v4.1
ATGGCTACACCATTGATAATGGGAATGGCGGTAGCAGCTACGGCATATGCTGGCAGATATGGCATCCAGGCTTGGCAGGCATTCAAAGCAAGGCCTCCAA
CTGCTAGAATGCGTAAATTTTACGAAGGTGGCTTTCAATCTGTCATGACGAGGAGAGAAGCAGCTCTAATACTTGGAGTAAGGGAAAGTACTGCTGCAGA
CAAGGTCAAGGAAGCACATAGGAGGGTGATGGTCGCAAACCATCCAGATGCAGGCGGAAGCCATTACCTTGCTTCTAAAATAAATGAAGCAAAGGATATC
TTACTTGGAAAAACAAAGGGTGGTGGATCTGCATTTTAG
AA sequence
>Potri.006G131200.1 pacid=42769887 polypeptide=Potri.006G131200.1.p locus=Potri.006G131200 ID=Potri.006G131200.1.v4.1 annot-version=v4.1
MATPLIMGMAVAATAYAGRYGIQAWQAFKARPPTARMRKFYEGGFQSVMTRREAALILGVRESTAADKVKEAHRRVMVANHPDAGGSHYLASKINEAKDI
LLGKTKGGGSAF

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT2G35795 Chaperone DnaJ-domain superfam... Potri.006G131200 0 1
AT5G56940 Ribosomal protein S16 family p... Potri.004G217400 1.41 0.8226 Pt-RPS16.2
Potri.001G340100 2.00 0.8573
AT3G17910 EMB3121, SURF1 SURFEIT 1, EMBRYO DEFECTIVE 31... Potri.012G045200 5.00 0.7827
AT1G22970 unknown protein Potri.008G126400 5.00 0.7390
AT3G59280 TXR1 THAXTOMIN A RESISTANT 1, Prote... Potri.012G108600 8.48 0.7767
AT1G73940 unknown protein Potri.001G453400 8.94 0.7711
AT2G46390 SDH8 succinate dehydrogenase 8, unk... Potri.014G095901 9.16 0.7576
AT5G39600 unknown protein Potri.004G228566 9.64 0.8141
AT5G38890 Nucleic acid-binding, OB-fold-... Potri.013G050400 10.81 0.7578
AT2G19690 PLA2-BETA phospholipase A2-beta (.1.2) Potri.006G149700 10.90 0.7496

Potri.006G131200 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.