Potri.006G196632 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT5G06620 124 / 2e-35 SDG38, ATXR4 SET domain protein 38 (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10013535 135 / 1e-39 AT5G06620 367 / 2e-127 SET domain protein 38 (.1)
PFAM info
Representative CDS sequence
>Potri.006G196632.1 pacid=42770658 polypeptide=Potri.006G196632.1.p locus=Potri.006G196632 ID=Potri.006G196632.1.v4.1 annot-version=v4.1
ATGTCCCATTTAGTCCGTTATAGCCGTTACCTTTCCCGCTTCAAAACCCCACTTTTCCCAAGATCCCAACATTCCACACTTCCCTTCTCCACCACCACAG
AAGATTACAACAAACCTTCCAGACCCGATCCGCCTCCGATTCGAGTCGCACTCACTGAGTCAGCTGGTCGAGGCGTGTTTTCCACTAGGAAAATCTGTGC
TGGAGATCTCATACACACTGCAAAACCTATTTTGGCTCATCCTTCTCTTTCAACTATTAACACTGTCTGTTATTTTTGCCTCAAGAAGTTAACTTCGACC
GAGTTTCATGGAAAAGGGGTTGCCTTTTGCAGTCAAGAGTGTAAAGAGAATGCTAAGGTGTTAAGTTGA
AA sequence
>Potri.006G196632.1 pacid=42770658 polypeptide=Potri.006G196632.1.p locus=Potri.006G196632 ID=Potri.006G196632.1.v4.1 annot-version=v4.1
MSHLVRYSRYLSRFKTPLFPRSQHSTLPFSTTTEDYNKPSRPDPPPIRVALTESAGRGVFSTRKICAGDLIHTAKPILAHPSLSTINTVCYFCLKKLTST
EFHGKGVAFCSQECKENAKVLS

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT5G06620 SDG38, ATXR4 SET domain protein 38 (.1) Potri.006G196632 0 1
AT5G16715 EMB2247 embryo defective 2247, ATP bin... Potri.004G090732 7.21 0.8306
Potri.012G048550 8.48 0.8252
AT1G53163 unknown protein Potri.001G398000 14.14 0.8026
Potri.008G043250 21.63 0.7977
AT1G35670 CPK11, ATCDPK2,... calcium-dependent protein kina... Potri.019G050950 22.91 0.7992
AT3G18680 Amino acid kinase family prote... Potri.007G110301 27.54 0.7950
AT5G66520 Tetratricopeptide repeat (TPR)... Potri.008G003600 27.71 0.8044
AT5G07670 RNI-like superfamily protein (... Potri.014G059100 31.22 0.7892
AT3G22380 TIC time for coffee (.1.2) Potri.010G089700 32.74 0.7987
AT1G77230 Tetratricopeptide repeat (TPR)... Potri.005G184001 36.93 0.7716

Potri.006G196632 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.