Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G53380 55 / 4e-10 Concanavalin A-like lectin protein kinase family protein (.1) AT5G55830 52 / 3e-09 Concanavalin A-like lectin protein kinase family protein (.1) AT5G10530 42 / 1e-05 Concanavalin A-like lectin protein kinase family protein (.1) AT4G28350 41 / 3e-05 Concanavalin A-like lectin protein kinase family protein (.1) AT5G06740 40 / 8e-05 Concanavalin A-like lectin protein kinase family protein (.1) AT1G52540 40 / 9e-05 Protein kinase superfamily protein (.1) AT5G42120 39 / 0.0002 Concanavalin A-like lectin protein kinase family protein (.1) AT3G15890 39 / 0.0002 Protein kinase superfamily protein (.1) AT4G02410 39 / 0.0003 Concanavalin A-like lectin protein kinase family protein (.1) AT5G65600 38 / 0.0003 Concanavalin A-like lectin protein kinase family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.018G028800 [exp] 120 / 4e-33 AT5G06740 371 / 1e-119 Concanavalin A-like lectin protein kinase family protein (.1) Potri.016G087800 [exp] 55 / 6e-10 AT3G53380 881 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1) Potri.001G368300 [exp] 54 / 1e-09 AT5G55830 853 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1) Potri.006G130000 [exp] 51 / 1e-08 AT3G53380 866 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1) Potri.011G093700 [exp] 49 / 5e-08 AT5G55830 849 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1) Potri.011G053200 [exp] 45 / 1e-06 AT4G04960 716 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1) Potri.003G094700 [exp] 44 / 4e-06 AT5G10530 764 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1) Potri.011G053100 [exp] 43 / 6e-06 AT4G04960 735 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1) Potri.006G193000 [exp] 42 / 1e-05 AT5G06740 688 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10019923 [exp] 51 / 9e-09 AT3G53380 927 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1) Lus10007075 [exp] 51 / 1e-08 AT5G10530 397 / 1e-133 Concanavalin A-like lectin protein kinase family protein (.1) Lus10026493 [exp] 49 / 1e-07 AT3G53380 872 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1) Lus10004277 [exp] 48 / 2e-07 AT5G10530 707 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1) Lus10020452 [exp] 46 / 6e-07 AT5G10530 510 / 2e-173 Concanavalin A-like lectin protein kinase family protein (.1) Lus10016620 [exp] 45 / 2e-06 AT5G55830 826 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1) Lus10029291 [exp] 43 / 2e-06 AT5G06740 95 / 2e-24 Concanavalin A-like lectin protein kinase family protein (.1) Lus10007074 [exp] 44 / 5e-06 AT5G10530 426 / 4e-143 Concanavalin A-like lectin protein kinase family protein (.1) Lus10029553 [exp] 43 / 8e-06 AT5G10530 591 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1) Lus10029555 [exp] 43 / 1e-05 AT5G10530 687 / 0.0 Concanavalin A-like lectin protein kinase family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.006G252666.1 pacid=42769662 polypeptide=Potri.006G252666.1.p locus=Potri.006G252666 ID=Potri.006G252666.1.v4.1 annot-version=v4.1 ATGCTAGAAGGAAAATATGATGAGCAACAAGTGAAGACGGCATTACTTGTTGGCCTGGCATGCTTGCATCCTGACACCAAGGGTCGTCCAACTATAAGAA AAGTAGAGCAAATTTTGTTGAAACCCAATGAGCCTCTAATGAAGGTGTCTGAATCGCGGCCGACTGCAATTTTTGTGCCATTATATTCCTCTGCGTCCAC CACAAGGTCTACAGCTGTTTTGGGTCTAAAAGTGACAATGCCTTGTTGCAGTCAGCCCCTTGATAAGATTATTACCCACCATGAAGATTGTGACATATAG
AA sequence Show only first row Show all	>Potri.006G252666.1 pacid=42769662 polypeptide=Potri.006G252666.1.p locus=Potri.006G252666 ID=Potri.006G252666.1.v4.1 annot-version=v4.1 MLEGKYDEQQVKTALLVGLACLHPDTKGRPTIRKVEQILLKPNEPLMKVSESRPTAIFVPLYSSASTTRSTAVLGLKVTMPCCSQPLDKIITHHEDCDI

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G53380			Concanavalin A-like lectin pro...		Potri.006G252666 [exp]	0	1
AT1G57790			F-box family protein (.1)		Potri.012G106800 [exp]	5.56	0.9112
AT5G12260			unknown protein		Potri.012G121826 [exp]	10.81	0.8982
AT5G40645			RPM1-interacting protein 4 (RI...		Potri.001G338500 [exp]	21.16	0.8748
					Potri.004G071450 [exp]	22.80	0.8705
AT5G17620			unknown protein		Potri.013G072300 [exp]	30.59	0.8716
AT1G21280			unknown protein		Potri.006G109250 [exp]	31.70	0.8607
AT4G25140		OLE1, OLEO1	oleosin 1 (.1)		Potri.001G080000 [exp]	31.93	0.8591
AT3G13850	AS2	LBD22	LOB domain-containing protein ...		Potri.003G039700 [exp]	32.40	0.8495
AT2G37030			SAUR-like auxin-responsive pro...		Potri.016G091500 [exp]	34.46	0.8687
AT2G28580			Plant protein of unknown funct...		Potri.007G132300 [exp]	35.69	0.8618

Compare expression of checked genes

Potri.006G252666 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.