Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G10120 37 / 0.0004 bHLH bHLH074, CIB4 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1) AT1G59640 37 / 0.0006 bHLH ZCW32, bHLH031, BPE, BPEUB, BPEP BIG PETAL UB, BIG PETAL P (.1.2) AT3G07340 37 / 0.0006 bHLH bHLH062 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1) AT5G48560 37 / 0.0006 bHLH bHLH078 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1) AT5G62610 37 / 0.0007 bHLH bHLH079 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1) AT5G50915 37 / 0.0008 bHLH bHLH137 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1), basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.006G267201 [exp] 54 / 7e-10 AT2G20142 61 / 5e-10 Toll-Interleukin-Resistance (TIR) domain family protein (.1) Potri.018G023600 [exp] 48 / 5e-08 AT2G20142 86 / 7e-19 Toll-Interleukin-Resistance (TIR) domain family protein (.1) Potri.001G007501 [exp] 39 / 0.0001 AT2G20142 77 / 2e-15 Toll-Interleukin-Resistance (TIR) domain family protein (.1) Potri.018G145554 [exp] 38 / 0.0002 AT4G15020 55 / 4e-09 hAT transposon superfamily (.1.2) Potri.012G104900 [exp] 38 / 0.0003 AT5G50915 177 / 3e-53 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1), basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.2) Potri.002G114700 [exp] 37 / 0.0004 AT1G10120 274 / 3e-89 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1) Potri.005G146500 [exp] 37 / 0.0004 AT1G10120 266 / 3e-86 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1) Potri.002G248500 [exp] 37 / 0.0006 AT3G07340 349 / 5e-115 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1) Potri.015G104200 [exp] 36 / 0.0009 AT5G50915 163 / 9e-48 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1), basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.2)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10012484 [exp] 37 / 0.0005 AT1G10120 202 / 4e-62 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1) Lus10006491 [exp] 37 / 0.0005 AT1G10120 213 / 5e-66 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1) Lus10033120 [exp] 37 / 0.0007 AT5G62610 265 / 9e-89 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1) Lus10036659 [exp] 37 / 0.0007 AT5G62610 256 / 3e-85 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1) Lus10003172 [exp] 37 / 0.0007 AT5G48560 205 / 4e-62 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1) Lus10002337 [exp] 37 / 0.0007 AT5G48560 258 / 7e-81 basic helix-loop-helix (bHLH) DNA-binding superfamily protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.006G258250.1 pacid=42767893 polypeptide=Potri.006G258250.1.p locus=Potri.006G258250 ID=Potri.006G258250.1.v4.1 annot-version=v4.1 ATGTATGGTGGTATCAGGTTATTTCCTTCCGGTGGGAAGGCTCTCTTGCTTGATGAAGTCATCCACTATTTTCAATCTCTTCAACAGCAAGCAGAGGAAA CAAATGAGTGGACGTCACTAATCACAAGCTTACTTCTAGAGGGTATATCTGCAATTTTTGACGAACTGGGTTTTGTATTGATGGGCATGGTAGTGGCATT TCTAGCTTTGCTTCTTTCTGTTGTCGATCTCATTCGCGAGGCTCGAAAGGAATAG
AA sequence Show only first row Show all	>Potri.006G258250.1 pacid=42767893 polypeptide=Potri.006G258250.1.p locus=Potri.006G258250 ID=Potri.006G258250.1.v4.1 annot-version=v4.1 MYGGIRLFPSGGKALLLDEVIHYFQSLQQQAEETNEWTSLITSLLLEGISAIFDELGFVLMGMVVAFLALLLSVVDLIREARKE

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
					Potri.006G258250 [exp]	0	1
AT5G40990		GLIP1	GDSL lipase 1 (.1)		Potri.004G084500 [exp]	11.18	0.9347
AT1G66870			Carbohydrate-binding X8 domain...		Potri.014G114500 [exp]	13.03	0.9334
AT4G25150			HAD superfamily, subfamily III...		Potri.001G191000 [exp]	21.63	0.9308
AT4G28780			GDSL-like Lipase/Acylhydrolase...		Potri.002G253400 [exp]	29.39	0.9205
AT2G26560		PLP2, PLAIIA, P...	PATATIN-LIKE PROTEIN 2, phosph...		Potri.019G014398 [exp]	32.78	0.9202
AT1G15360	AP2_ERF	WIN1, SHN1	WAX INDUCER 1, SHINE 1, Integr...		Potri.018G131400 [exp]	36.08	0.9200
AT5G62420			NAD(P)-linked oxidoreductase s...		Potri.001G125400 [exp]	37.46	0.8398
AT5G04530		KCS19	3-ketoacyl-CoA synthase 19 (.1...		Potri.013G119800 [exp]	41.47	0.9186
AT1G52340		SIS4, SDR1, ISI...	SHORT-CHAIN DEHYDROGENASE REDU...		Potri.006G206800 [exp]	43.98	0.9168	CTS2.10
AT5G20740			Plant invertase/pectin methyle...		Potri.006G137800 [exp]	46.79	0.9166

Compare expression of checked genes

Potri.006G258250 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.