Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G47110 58 / 2e-11 Leucine-rich repeat protein kinase family protein (.1) AT5G39390 58 / 2e-11 Leucine-rich repeat protein kinase family protein (.1) AT3G47570 55 / 2e-10 Leucine-rich repeat protein kinase family protein (.1) AT5G20480 53 / 1e-09 EFR EF-TU receptor (.1) AT3G47580 52 / 2e-09 Leucine-rich repeat protein kinase family protein (.1) AT2G26380 52 / 3e-09 Leucine-rich repeat (LRR) family protein (.1) AT3G47090 50 / 1e-08 Leucine-rich repeat protein kinase family protein (.1) AT1G33670 49 / 2e-08 Leucine-rich repeat (LRR) family protein (.1) AT3G12610 48 / 5e-08 DRT100 DNA-DAMAGE REPAIR/TOLERATION 100, Leucine-rich repeat (LRR) family protein (.1) AT1G33600 48 / 7e-08 Leucine-rich repeat (LRR) family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.011G103000 [exp] 92 / 2e-23 AT3G47570 827 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Potri.011G102800 [exp] 91 / 7e-23 AT3G47570 862 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Potri.011G102900 [exp] 90 / 1e-22 AT3G47570 843 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Potri.008G007866 [exp] 80 / 5e-19 AT3G47570 770 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Potri.017G115900 [exp] 77 / 6e-18 AT3G47570 810 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Potri.011G102700 [exp] 75 / 2e-17 AT3G47570 810 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Potri.008G033700 [exp] 72 / 4e-16 AT3G47570 799 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Potri.013G133100 [exp] 71 / 4e-16 AT3G47570 761 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Potri.019G100901 [exp] 71 / 5e-16 AT5G39390 394 / 9e-133 Leucine-rich repeat protein kinase family protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10004388 [exp] 79 / 1e-18 AT3G47570 815 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Lus10011387 [exp] 78 / 3e-18 AT3G47570 782 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Lus10011386 [exp] 78 / 3e-18 AT3G47570 787 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Lus10030903 [exp] 76 / 8e-18 AT3G47570 798 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Lus10038686 [exp] 76 / 1e-17 AT3G47570 752 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Lus10030587 [exp] 71 / 8e-16 AT3G47570 776 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Lus10011388 [exp] 70 / 1e-15 AT3G47570 757 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Lus10038598 [exp] 70 / 1e-15 AT3G47570 671 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Lus10020140 [exp] 70 / 1e-15 AT3G47570 740 / 0.0 Leucine-rich repeat protein kinase family protein (.1) Lus10026938 [exp] 70 / 2e-15 AT5G20480 735 / 0.0 EF-TU receptor (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF08263 [poplar] [flax] LRRNT_2 Leucine rich repeat N-terminal domain
Representative CDS sequence Show only first row Show all	>Potri.006G273050.1 pacid=42770449 polypeptide=Potri.006G273050.1.p locus=Potri.006G273050 ID=Potri.006G273050.1.v4.1 annot-version=v4.1 ATGAGATCAAGATTTGGTGTTCATCATGCAATCATTCTCCTCTTTAGCATTAATGGCTTTGTTAATGGAGGAGAGAATGAAGCAGACCAAGAAGCCTTGC TTGAATTCAAGACCAAGATCACCAGTGACCCTCTTGGCATCATGAACTTATGGAATACATCAGCTCAGTTTTGCCAGTGGTATGGTGTCAAATGTAGCCC TAAGCACCAAAGGGTTACTGTTTTGGACCTTAACTCACAGCTCCTTTAG
AA sequence Show only first row Show all	>Potri.006G273050.1 pacid=42770449 polypeptide=Potri.006G273050.1.p locus=Potri.006G273050 ID=Potri.006G273050.1.v4.1 annot-version=v4.1 MRSRFGVHHAIILLFSINGFVNGGENEADQEALLEFKTKITSDPLGIMNLWNTSAQFCQWYGVKCSPKHQRVTVLDLNSQLL

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G47110			Leucine-rich repeat protein ki...		Potri.006G273050 [exp]	0	1
AT2G44890		CYP704A1	"cytochrome P450, family 704, ...		Potri.012G131200 [exp]	14.59	0.7957
AT3G07040		RPS3, RPM1	RESISTANCE TO PSEUDOMONAS SYRI...		Potri.001G134601 [exp]	15.71	0.8048
AT5G49960			unknown protein		Potri.019G097000 [exp]	55.56	0.7325
AT5G01220		SQD2	sulfoquinovosyldiacylglycerol ...		Potri.016G112600 [exp]	62.35	0.7413	SQD2.1
AT4G10500			2-oxoglutarate (2OG) and Fe(II...		Potri.011G150400 [exp]	71.74	0.7443
AT5G19790	AP2_ERF	RAP2.11	related to AP2 11 (.1)		Potri.003G220200 [exp]	109.79	0.7469	ERF59
AT1G58030		CAT2	cationic amino acid transporte...		Potri.013G065000 [exp]	117.68	0.6789	Pt-CAT3.2
AT4G27290			S-locus lectin protein kinase ...		Potri.011G125851 [exp]	133.88	0.7255
					Potri.010G161250 [exp]	159.56	0.7212
AT1G64295			F-box associated ubiquitinatio...		Potri.014G187100 [exp]	192.40	0.7011

Compare expression of checked genes

Potri.006G273050 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.