Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G66910 86 / 1e-20 Disease resistance protein (CC-NBS-LRR class) family (.1) AT5G66900 84 / 1e-19 Disease resistance protein (CC-NBS-LRR class) family (.1) AT5G66890 73 / 6e-16 Leucine-rich repeat (LRR) family protein (.1) AT4G33300 64 / 1e-12 ADR1-L1 ADR1-like 1 (.1.2) AT1G33560 61 / 8e-12 ADR1 ACTIVATED DISEASE RESISTANCE 1, Disease resistance protein (CC-NBS-LRR class) family (.1) AT5G47280 59 / 4e-11 ADR1-L3 ADR1-like 3 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.007G039300 [exp] 196 / 7e-60 AT5G66900 540 / 0.0 Disease resistance protein (CC-NBS-LRR class) family (.1) Potri.007G039000 [exp] 140 / 9e-40 AT5G66900 343 / 2e-107 Disease resistance protein (CC-NBS-LRR class) family (.1) Potri.007G038900 [exp] 136 / 1e-39 AT5G66900 336 / 4e-108 Disease resistance protein (CC-NBS-LRR class) family (.1) Potri.007G039100 [exp] 140 / 2e-39 AT5G66900 474 / 3e-156 Disease resistance protein (CC-NBS-LRR class) family (.1) Potri.007G038700 [exp] 99 / 4e-25 AT5G66900 481 / 3e-158 Disease resistance protein (CC-NBS-LRR class) family (.1) Potri.002G129300 [exp] 69 / 1e-14 AT4G33300 902 / 0.0 ADR1-like 1 (.1.2) Potri.014G035700 [exp] 61 / 1e-11 AT4G33300 889 / 0.0 ADR1-like 1 (.1.2)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10020779 [exp] 130 / 6e-36 AT5G66900 434 / 5e-141 Disease resistance protein (CC-NBS-LRR class) family (.1) Lus10022464 [exp] 121 / 6e-33 AT5G66900 531 / 2e-177 Disease resistance protein (CC-NBS-LRR class) family (.1) Lus10007359 [exp] 119 / 3e-32 AT5G66900 473 / 3e-154 Disease resistance protein (CC-NBS-LRR class) family (.1) Lus10021769 [exp] 67 / 9e-14 AT4G33300 583 / 0.0 ADR1-like 1 (.1.2) Lus10032759 [exp] 62 / 4e-12 AT1G33560 543 / 0.0 ACTIVATED DISEASE RESISTANCE 1, Disease resistance protein (CC-NBS-LRR class) family (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.007G039201.1 pacid=42765101 polypeptide=Potri.007G039201.1.p locus=Potri.007G039201 ID=Potri.007G039201.1.v4.1 annot-version=v4.1 ATGTGGATGGAATTGTACAAGCTAGATGAAGAAGCATATGCCGTTGCCAAAATCCAGGAACTCTCTAACATGAATTTAGTTGATCTTGTAGTCACAAGGA ATTATCTAAGCAGCTGCTATAATCATCACTTCGCTATGCAGCATGATCTTCTAAGAAAGCTAGCTATCCATCAAAGTGACTTGGAACCACTGGAGCAGAG AAAAAGACAAGTTCTGGAGATCTGTGCAAACAATGTCCCTGACTGGTGGATGGAACAGAAGCAGCCAAGCATTAGTAGCCGCCTGTTGTCTATCTCCACA GATGAAAACTTCTCACCAAGTTGGTGCTCCATGCAAGCTCCTGAAGTTGAGGTTATGATCCTTAATTGTCGACCATGA
AA sequence Show only first row Show all	>Potri.007G039201.1 pacid=42765101 polypeptide=Potri.007G039201.1.p locus=Potri.007G039201 ID=Potri.007G039201.1.v4.1 annot-version=v4.1 MWMELYKLDEEAYAVAKIQELSNMNLVDLVVTRNYLSSCYNHHFAMQHDLLRKLAIHQSDLEPLEQRKRQVLEICANNVPDWWMEQKQPSISSRLLSIST DENFSPSWCSMQAPEVEVMILNCRP

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G66910			Disease resistance protein (CC...		Potri.007G039201 [exp]	0	1
AT5G20940			Glycosyl hydrolase family prot...		Potri.009G154032 [exp]	10.67	0.9724
AT5G11390		WIT1	WPP domain-interacting protein...		Potri.004G111350 [exp]	12.32	0.9723
					Potri.014G163733 [exp]	15.09	0.9719
AT5G05950		MEE60	maternal effect embryo arrest ...		Potri.009G038500 [exp]	17.20	0.9019
AT2G31500		CPK24	calcium-dependent protein kina...		Potri.017G031900 [exp]	17.40	0.8753
AT4G27290			S-locus lectin protein kinase ...		Potri.010G017900 [exp]	19.87	0.8973
AT4G12560		CPR1, CPR30	CONSTITUTIVE EXPRESSER OF PR G...		Potri.006G010800 [exp]	20.71	0.9685
AT2G31690			alpha/beta-Hydrolases superfam...		Potri.014G150700 [exp]	22.22	0.9669
AT1G06930			unknown protein		Potri.019G127400 [exp]	22.62	0.9649
AT2G27930			PLATZ transcription factor fam...		Potri.009G003200 [exp]	25.09	0.8496

Compare expression of checked genes

Potri.007G039201 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.