Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G05680 59 / 1e-11 UGT74E2 Uridine diphosphate glycosyltransferase 74E2 (.1) AT1G05675 57 / 3e-11 UDP-Glycosyltransferase superfamily protein (.1) AT2G31790 55 / 2e-10 UDP-Glycosyltransferase superfamily protein (.1) AT2G43840 54 / 5e-10 UGT74F1 UDP-glycosyltransferase 74 F1 (.1.2) AT1G05560 53 / 1e-09 UGT75B1, UGT1 UDP-GLUCOSE TRANSFERASE 1, UDP-glucosyltransferase 75B1 (.1) AT2G43820 52 / 2e-09 SGT1, ATSAGT1, GT, UGT74F2 UDP-glucose:salicylic acid glucosyltransferase 1, Arabidopsis thaliana salicylic acid glucosyltransferase 1, UDP-glucosyltransferase 74F2 (.1) AT2G31750 52 / 3e-09 UGT74D1 UDP-glucosyl transferase 74D1 (.1) AT1G05530 50 / 7e-09 UGT75B2, UGT2 UDP-GLUCOSYL TRANSFERASE 2, UDP-glucosyl transferase 75B2 (.1) AT1G24100 50 / 8e-09 UGT74B1 UDP-glucosyl transferase 74B1 (.1) AT4G15550 48 / 6e-08 IAGLU indole-3-acetate beta-D-glucosyltransferase (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.007G140700 [exp] 123 / 2e-35 AT1G05680 357 / 2e-120 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.007G140300 [exp] 100 / 1e-26 AT1G05680 457 / 4e-159 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.007G141700 [exp] 85 / 2e-22 AT1G05680 237 / 4e-77 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.004G179300 [exp] 84 / 8e-21 AT1G05680 446 / 1e-154 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.017G032300 [exp] 78 / 1e-18 AT1G05675 465 / 6e-162 UDP-Glycosyltransferase superfamily protein (.1) Potri.017G032733 [exp] 78 / 1e-18 AT1G05680 444 / 6e-154 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.017G032700 [exp] 78 / 1e-18 AT1G05680 444 / 6e-154 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.017G032500 [exp] 77 / 3e-18 AT1G05680 446 / 1e-154 Uridine diphosphate glycosyltransferase 74E2 (.1) Potri.001G389200 [exp] 74 / 3e-17 AT1G05680 494 / 2e-173 Uridine diphosphate glycosyltransferase 74E2 (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10024117 [exp] 68 / 4e-15 AT1G05675 385 / 4e-130 UDP-Glycosyltransferase superfamily protein (.1) Lus10009408 [exp] 62 / 2e-14 AT1G05680 108 / 3e-29 Uridine diphosphate glycosyltransferase 74E2 (.1) Lus10029469 [exp] 64 / 7e-14 AT1G05680 136 / 5e-37 Uridine diphosphate glycosyltransferase 74E2 (.1) Lus10009412 [exp] 63 / 4e-13 AT2G43820 474 / 1e-165 UDP-glucose:salicylic acid glucosyltransferase 1, Arabidopsis thaliana salicylic acid glucosyltransferase 1, UDP-glucosyltransferase 74F2 (.1) Lus10024118 [exp] 61 / 1e-12 AT1G05675 375 / 2e-126 UDP-Glycosyltransferase superfamily protein (.1) Lus10020556 [exp] 61 / 1e-12 AT2G43820 472 / 1e-164 UDP-glucose:salicylic acid glucosyltransferase 1, Arabidopsis thaliana salicylic acid glucosyltransferase 1, UDP-glucosyltransferase 74F2 (.1) Lus10010468 [exp] 61 / 2e-12 AT1G05675 368 / 7e-124 UDP-Glycosyltransferase superfamily protein (.1) Lus10008742 [exp] 60 / 3e-12 AT2G43840 478 / 6e-167 UDP-glycosyltransferase 74 F1 (.1.2) Lus10003809 [exp] 60 / 4e-12 AT1G05675 337 / 1e-111 UDP-Glycosyltransferase superfamily protein (.1) Lus10009417 [exp] 57 / 1e-11 AT1G05680 172 / 1e-51 Uridine diphosphate glycosyltransferase 74E2 (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.007G117302.1 pacid=42765845 polypeptide=Potri.007G117302.1.p locus=Potri.007G117302 ID=Potri.007G117302.1.v4.1 annot-version=v4.1 ATGAAAAAAGGGATTGTCACCAAAGAAGAGGTAGAAAGGTGCATAAGGGAAGTCCTGGAAAGTGAAAAAAGCAATGCGATAAGAGGGAATTCTGATAAAT GGAAGAAATTAGCCAAAACAGCAGTTGATATAAGTGGGAGCTCTGATAAGAATATTGAGGAGTTTGTAACTGAGGTTGCGTGCAAGTCCCAAAGGTATCA TAGAGTGAGGCCCTTACTGCCTTGA
AA sequence Show only first row Show all	>Potri.007G117302.1 pacid=42765845 polypeptide=Potri.007G117302.1.p locus=Potri.007G117302 ID=Potri.007G117302.1.v4.1 annot-version=v4.1 MKKGIVTKEEVERCIREVLESEKSNAIRGNSDKWKKLAKTAVDISGSSDKNIEEFVTEVACKSQRYHRVRPLLP

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G05680		UGT74E2	Uridine diphosphate glycosyltr...		Potri.007G117302 [exp]	0	1
					Potri.017G109401 [exp]	15.84	0.9144
AT3G53310	B3	REM20	AP2/B3-like transcriptional fa...		Potri.003G017566 [exp]	18.16	0.9094
AT3G63470		SCPL40	serine carboxypeptidase-like 4...		Potri.001G261201 [exp]	21.09	0.8623
					Potri.001G062301 [exp]	22.44	0.8257
					Potri.009G050500 [exp]	36.46	0.9013
					Potri.003G151850 [exp]	47.90	0.8989
AT3G53310	B3	REM20	AP2/B3-like transcriptional fa...		Potri.003G015900 [exp]	52.15	0.8981
AT2G31130			unknown protein		Potri.011G065100 [exp]	61.62	0.8910
AT2G47020			Peptide chain release factor 1...		Potri.002G188200 [exp]	83.16	0.8827
					Potri.012G032376 [exp]	137.45	0.8482

Compare expression of checked genes

Potri.007G117302 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.