Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	No hit found
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G152750 [exp] 54 / 1e-12 ND / Potri.019G004102 [exp] 52 / 5e-12 ND / Potri.003G072050 [exp] 52 / 9e-12 ND / Potri.013G068250 [exp] 50 / 3e-11 ND / Potri.016G051050 [exp] 50 / 3e-11 ND / Potri.003G072250 [exp] 50 / 6e-11 ND / Potri.011G027001 [exp] 49 / 8e-11 ND / Potri.008G223332 [exp] 49 / 9e-11 ND / Potri.008G185350 [exp] 50 / 1e-10 ND /
Flax homologues Show only best Show top 10	No hit found
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.008G012050.1 pacid=42806863 polypeptide=Potri.008G012050.1.p locus=Potri.008G012050 ID=Potri.008G012050.1.v4.1 annot-version=v4.1 ATGCCAATGATGTTTTTTCATTTTTTAAAAATCATTTTTGACATCAGCACATCAAAACGATCCAAAATGTACAAACCATATTAA
AA sequence Show only first row Show all	>Potri.008G012050.1 pacid=42806863 polypeptide=Potri.008G012050.1.p locus=Potri.008G012050 ID=Potri.008G012050.1.v4.1 annot-version=v4.1 MPMMFFHFLKIIFDISTSKRSKMYKPY

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
					Potri.008G012050 [exp]	0	1
AT1G54560		PCR1, ATXIE, XI...	MYOSIN XI E, Myosin family pro...		Potri.019G013800 [exp]	8.48	0.5665
AT5G28780			PIF1 helicase (.1)		Potri.003G004501 [exp]	9.79	0.5696
					Potri.012G100750 [exp]	14.96	0.5696
AT2G35110		NAPP, GRL, NAP1	NCK-ASSOCIATED PROTEIN 1, GNAR...		Potri.015G123001 [exp]	16.91	0.4856
AT3G30180		CYP85A2, BR6OX2	brassinosteroid-6-oxidase 2 (....		Potri.010G156800 [exp]	17.66	0.5528
AT1G69940		ATPPME1	Pectin lyase-like superfamily ...		Potri.012G114900 [exp]	19.67	0.5578
AT5G23120		HCF136	HIGH CHLOROPHYLL FLUORESCENCE ...		Potri.005G092950 [exp]	20.49	0.5193
AT4G09960	MADS	AGL11, STK	SEEDSTICK, AGAMOUS-like 11, K-...		Potri.013G104900 [exp]	21.63	0.5498	AGL11.2
					Potri.001G054301 [exp]	24.26	0.4921
AT1G43760			DNAse I-like superfamily prote...		Potri.010G033133 [exp]	39.11	0.5110

Compare expression of checked genes

Potri.008G012050 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.