Potri.008G036000 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.010G226200 136 / 5e-43 ND /
Potri.004G213900 47 / 4e-08 ND /
Potri.009G008300 44 / 7e-07 ND /
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10021443 51 / 2e-09 ND /
Lus10017461 42 / 4e-06 ND /
Lus10016122 43 / 9e-06 AT4G24270 45 / 1e-05 EMBRYO DEFECTIVE 140 (.1.2)
PFAM info
Representative CDS sequence
>Potri.008G036000.1 pacid=42807412 polypeptide=Potri.008G036000.1.p locus=Potri.008G036000 ID=Potri.008G036000.1.v4.1 annot-version=v4.1
ATGTCTAGCCCTACTCTTTTCTCCATGGCTTTCTTCTATCTTATCCTCCTCCTATCTCCACCACCAATGCTGATTGGTACAAATTCCATGGCTAGAGTTG
CGGTGGCGACGCGGCCATTGGAATCTAAATCTTCGCGTTACGAGACATTGAAGCCGAAAACTAATCATGGGCAGCAAGAGTTCCATGGTAGAGAAGTGGA
GAATTGCTTGCCAAAAGGATTCCACCCTACTTCTGCCCCTAGCCGATATATAAATTATCATACTCTTGGGTCAACAAGATGTACTCCAAGCAAACATGTT
GATGCACCATGA
AA sequence
>Potri.008G036000.1 pacid=42807412 polypeptide=Potri.008G036000.1.p locus=Potri.008G036000 ID=Potri.008G036000.1.v4.1 annot-version=v4.1
MSSPTLFSMAFFYLILLLSPPPMLIGTNSMARVAVATRPLESKSSRYETLKPKTNHGQQEFHGREVENCLPKGFHPTSAPSRYINYHTLGSTRCTPSKHV
DAP

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.008G036000 0 1
AT5G67400 RHS19 root hair specific 19 (.1) Potri.007G053400 1.41 0.8922
AT5G42750 BKI1 BRI1 kinase inhibitor 1 (.1) Potri.002G127100 5.00 0.9133
AT2G40610 ATHEXPALPHA1.11... expansin A8 (.1) Potri.016G135200 9.94 0.8607 PtEXPA13,EXP2.9
AT1G66920 Protein kinase superfamily pro... Potri.017G035500 13.85 0.8506
AT1G67910 unknown protein Potri.018G079200 14.07 0.8895
AT1G69040 ACR4 ACT domain repeat 4 (.1.2) Potri.012G083000 16.97 0.8551
Potri.010G226200 17.34 0.8267
AT3G55070 LisH/CRA/RING-U-box domains-co... Potri.008G047300 17.94 0.8512
AT3G62550 Adenine nucleotide alpha hydro... Potri.002G196700 22.04 0.8503
AT4G39710 PnsL4, FKBP16-2 Photosynthetic NDH subcomplex... Potri.007G087401 25.37 0.8439

Potri.008G036000 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.