Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G06610 137 / 2e-43 DNA-binding enhancer protein-related (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.010G146100 [exp] 176 / 1e-58 AT3G06610 141 / 6e-45 DNA-binding enhancer protein-related (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10016913 [exp] 160 / 3e-52 AT3G06610 164 / 5e-54 DNA-binding enhancer protein-related (.1) Lus10037773 [exp] 160 / 3e-52 AT3G06610 165 / 3e-54 DNA-binding enhancer protein-related (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.008G105000.1 pacid=42808820 polypeptide=Potri.008G105000.1.p locus=Potri.008G105000 ID=Potri.008G105000.1.v4.1 annot-version=v4.1 ATGGAAGGTGGAGACGGAGAAGGAATAGACAGAGTAGTAGATTCGAAAGATTTACAGCAACAAAGCAAAGCACTTGATAAACTCACCGACCGTGTAGAAG ATCGCCAACTCGATTCTACTCGTGTTCAAGAAGCTATGGCTTCTATTTCCGCTTCTGCTGAAGCTGATGCTAACGCTATGAGATTGAGGGAGAAAGAATT GGCTGCTGTGAAGATCAACGCAGCTGATGTTGACATAATTGCAAATGAATTAGAGTTGGACAAGAAGGTAGCAGAGAGAACCTTACGCGAGCACAAGGGC GATGCTGTCGCTGCTATCCGCCATCTTCTTCACTAG
AA sequence Show only first row Show all	>Potri.008G105000.1 pacid=42808820 polypeptide=Potri.008G105000.1.p locus=Potri.008G105000 ID=Potri.008G105000.1.v4.1 annot-version=v4.1 MEGGDGEGIDRVVDSKDLQQQSKALDKLTDRVEDRQLDSTRVQEAMASISASAEADANAMRLREKELAAVKINAADVDIIANELELDKKVAERTLREHKG DAVAAIRHLLH

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G06610			DNA-binding enhancer protein-r...		Potri.008G105000 [exp]	0	1
AT2G30260		U2B''	U2 small nuclear ribonucleopro...		Potri.019G121400 [exp]	1.41	0.8860
AT2G35790			unknown protein		Potri.010G219400 [exp]	2.00	0.8859
AT2G01640			unknown protein		Potri.009G097000 [exp]	4.00	0.8185
AT3G13882			Ribosomal protein L34 (.1.2)		Potri.003G041100 [exp]	4.89	0.8288
AT1G80750			Ribosomal protein L30/L7 famil...		Potri.003G180700 [exp]	5.47	0.8551
AT5G59950			RNA-binding (RRM/RBD/RNP motif...		Potri.001G236900 [exp]	7.34	0.8152
AT5G23140		NCLPP7, NCLPP2,...	nuclear-encoded CLP protease P...		Potri.007G071700 [exp]	9.16	0.8743
AT2G20690			lumazine-binding family protei...		Potri.013G131800 [exp]	10.58	0.8425
AT5G46160			Ribosomal protein L14p/L23e fa...		Potri.010G022800 [exp]	11.74	0.8062	RPL14.1
AT5G64680			unknown protein		Potri.001G068500 [exp]	12.40	0.8258

Compare expression of checked genes

Potri.008G105000 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.