Potri.008G223332 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues

No hit found

Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.004G152750 51 / 1e-11 ND /
Potri.013G068250 51 / 2e-11 ND /
Potri.016G051050 51 / 2e-11 ND /
Potri.016G085101 51 / 2e-11 ND /
Potri.019G004102 50 / 6e-11 ND /
Potri.008G012050 49 / 9e-11 ND /
Potri.019G036280 49 / 1e-10 ND /
Potri.013G056750 49 / 1e-10 ND /
Potri.011G095401 48 / 3e-10 ND /
Flax homologues

No hit found

PFAM info
Representative CDS sequence
>Potri.008G223332.1 pacid=42807168 polypeptide=Potri.008G223332.1.p locus=Potri.008G223332 ID=Potri.008G223332.1.v4.1 annot-version=v4.1
ATGTCAATGATGTTTTTTTATTTTTTAAAAATTATTTTTGATATCAGCACATCAAAAAGATCAAAAACATATAAACCATATTAA
AA sequence
>Potri.008G223332.1 pacid=42807168 polypeptide=Potri.008G223332.1.p locus=Potri.008G223332 ID=Potri.008G223332.1.v4.1 annot-version=v4.1
MSMMFFYFLKIIFDISTSKRSKTYKPY

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
Potri.008G223332 0 1
AT1G44414 unknown protein Potri.002G083100 79.99 0.4009
Potri.016G115250 87.87 0.4255
Potri.015G051201 120.83 0.3795
Potri.007G075066 205.53 0.3711

Potri.008G223332 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.