Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G02420 45 / 6e-07 unknown protein AT5G02220 37 / 0.0002 unknown protein
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G212300 [exp] 166 / 2e-54 AT5G02420 43 / 8e-06 unknown protein Potri.008G029600 [exp] 77 / 2e-19 AT5G02420 48 / 5e-08 unknown protein Potri.010G231600 [exp] 76 / 5e-19 AT5G02420 44 / 1e-06 unknown protein Potri.010G231700 [exp] 67 / 1e-15 AT5G04470 / SIAMESE, cyclin-dependent protein kinase inhibitors (.1) Potri.001G239000 [exp] 43 / 5e-06 AT5G02420 59 / 1e-11 unknown protein Potri.009G030200 [exp] 43 / 8e-06 AT5G02420 49 / 5e-08 unknown protein Potri.006G084700 [exp] 41 / 4e-05 AT5G02420 57 / 1e-10 unknown protein Potri.016G100000 [exp] 38 / 6e-05 AT5G02220 39 / 1e-05 unknown protein Potri.014G090000 [exp] 37 / 0.0003 ND /
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10037925 [exp] 57 / 2e-11 AT5G02420 47 / 2e-07 unknown protein Lus10038653 [exp] 54 / 3e-10 AT5G02420 47 / 2e-07 unknown protein Lus10016559 [exp] 44 / 5e-06 AT2G37610 39 / 2e-04 unknown protein Lus10040827 [exp] 42 / 3e-05 AT3G20898 44 / 8e-06 unknown protein
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.009G003400.1 pacid=42772790 polypeptide=Potri.009G003400.1.p locus=Potri.009G003400 ID=Potri.009G003400.1.v4.1 annot-version=v4.1 ATGTCTAAAGATCACAAAACCCAGAAGAATCTACAAAAAGTTCAACAATCCGTATCACAAGGTCATGAACAAGAAGAAGGAGAGCTAGAGAATATTCAAG TTGATGATCAAGAAGAGTGCAAAACACCAACCTCTAGTGATCACAAGATACCTGCCATTCAAAGCTGCCCACCAACACCGAGAAAGAAGGTGCAAGTTTT TGAGCATAAGAGAAAACTTCCAGAGTTCTTCGAAACTACAAATAACGATGAGGTAGAGTCGTTTTTTCGATCAAGCTTTGAGATATCTACTCGTGTCAAC GAATCTCGTCCCATGAAAAGAAGATGCAGAAGTTATTAA
AA sequence Show only first row Show all	>Potri.009G003400.1 pacid=42772790 polypeptide=Potri.009G003400.1.p locus=Potri.009G003400 ID=Potri.009G003400.1.v4.1 annot-version=v4.1 MSKDHKTQKNLQKVQQSVSQGHEQEEGELENIQVDDQEECKTPTSSDHKIPAIQSCPPTPRKKVQVFEHKRKLPEFFETTNNDEVESFFRSSFEISTRVN ESRPMKRRCRSY

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G02420			unknown protein		Potri.009G003400 [exp]	0	1
AT2G46680	HD	ATHB7, ATHB-7	ARABIDOPSIS THALIANA HOMEOBOX ...		Potri.012G023700 [exp]	3.46	0.9249
AT5G36110		CYP716A1	"cytochrome P450, family 716, ...		Potri.019G057901 [exp]	5.65	0.9349
AT1G13990			unknown protein		Potri.010G164400 [exp]	7.74	0.9114
AT1G20560		AAE1	acyl activating enzyme 1 (.1.2...		Potri.005G250700 [exp]	10.67	0.9036
AT4G05160			AMP-dependent synthetase and l...		Potri.004G102000 [exp]	12.84	0.8945	Ptr4CL8
					Potri.008G181801 [exp]	13.67	0.8849
AT3G44880		PAO, LLS1, ACD1	LETHAL LEAF-SPOT 1 HOMOLOG, AC...		Potri.004G217200 [exp]	14.42	0.9016
AT1G13680			PLC-like phosphodiesterases su...		Potri.011G144900 [exp]	16.12	0.9136
AT1G77930			Chaperone DnaJ-domain superfam...		Potri.002G090600 [exp]	16.52	0.9030
AT3G10230		AtLCY, LYC	lycopene cyclase (.1.2)		Potri.009G159800 [exp]	18.97	0.8991

Compare expression of checked genes

Potri.009G003400 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.